[DEBUG-WINDOW 처리영역 보기]
서비스바로가기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 회원가입   로그인
검색어 자동완성
스폰서배너광고 안내  배너1 배너2 배너3 배너4
과학으로 본 코로나19 (COVID-19)
카테고리  1차  2차
기간설정   ~
'RNA' 관련 검색광고입니다.
RNA 이제 (주)필코리아테크놀로지와 함께하세요. T:02-2105-7020 F:02-2105-7025 info@philekorea.co.kr
e브릭몰    1,271건 더보기 외부제휴사 광고 AD
실험Q&A    580건 정확도순 날짜순
Q. sirna
sirna 의 negative control 을 transfection 시 viability 에 전혀 손상이 없었는지.. 혹시 해보신분들의 경험을 기다립니다.
A.  제가 2년넘게 5종의 세포로 3개의 유전자를 이용한 실험한 경험으론 negative control은 손상이 없어야 정상입니다. 만약 targetting과 negative control이 같은 발현 저해 현상을 보이면 디자인이 잘못 된것입니다.
답변 1  |  2006.05.03
Q. sirna
.sinra 로성공한 그룹이 없다는 글을 읽었습니다. sirna 를 시도해보려하는데 비용도 그리 저렴한 편은 아닌듯한데..좀 걱정이 됩니다. transfection 효율때문인지..아님 아직 working 이 제대로 안되서 ...
A.  siRNA를 이용해서 성공한 곳이 없다구요? 그럴리가요... 어떤 의미에서 성공한 그룹이 없다고 하셨는진 모르겠 ... 실험실에서도 siRNA를 써서 knock-down 시켰구요 울 앞방에서도 siRNA써서 재미봤는데요. ...
답변 1  |  2006.02.27
Q. siRNA 에 대한 질문입니다.
안녕하세요... 제가 siRNA 실험을 하고자 합니다. 그런데 control 로 쓸 것이 필요한데 일반적으 ... 조합을 비교해야 하나요?? 아니면 scrambled siRNA, targeted siRNA 이렇게 두개의 조합만을 비교하면 되나요? ...
A.  Transfection자체가 cell에 많은 영향을 주기 때문에 세가지를 사용해야 옳다고 봅니다. 최소한 저는 지금까진 그래왔습니다.
답변 2  |  2005.12.28
Q. SiRNA 제작
실험이 별로 없고 다음과 같은 것이 있었습니다. Glucokinase siRNA was 21 nucleotides long and contained symmetric 3'' overhangs of two uridines that targeted the DNA sequence GGTACGACTTGTGCTGCTTAA (pancreatic glucokinase, GenBank accession no. M258 ...
A.   물론 siRNA를 발빠르게 시작한 ambion등의 회사에서는 siRNA design시에 UU나 TT overhang을 하여 design하도록 site를 만들어 놓았습니다. 그래서 아마도 햇갈리시는 거라고 생각되네요. 보통 19mer를 사용한다고 ...
답변 1  |  2006.08.25
Q. siRNA 효율에 관한 질문입니다 조언 부탁드립니다
되는지 경험자분의 말씀을 듣고 싶습니다. 혹 72시간 후 siRNA 처리를 한번 더 해보신 분 계시나요? 이 외에도 효율을 높이는데 도움이 되는 TIP이 있으시다면 공유 부탁드려요~ ^ ...
답변 0  |  2007.02.08
Q. siRNA 실험 문의드려요~
. 이런 결과를 어떻게 해석해야 하는지 의문이구요,, 2. 외산siRNA가 잘 감소된다고 해서 시약 기다리는데, 몇달 소요됐거든요; 아예 시약을 국산 바이오니아에서 다시 주문해서 처음부터 다시 실험을 ...
A.  경우 해당 siRNA를 쓰지 않는 게 좋은 것으로 알고 있습니다. siRNA 농도 및 시간별로 처리한 후 상기 실험을 다시 해 보시길 권합니다~ 도움이 되길 바랍니다 ...
답변 3  |  2015.08.22
Q. 동물에다 siRNA하는 방법에 대해
찾아서 만든다고 하는데. 그럼 이렇게 만들어진 여러개의 siRNA를 한꺼번에 동물한테 주입해야하는지 각각 따로 주입해서 어느것이 잘되는지 효과를 봐야하는거지요. 두 방법다 필요할꺼같은데. ...
A.  동물에다가 하시는 거면 lentivirus로 infection 시키는 방법은 어떠세요??^^
답변 2  |  2007.05.08
Q. 동물에다 siRNA할때요..
찾아서 만든다고 하는데. 그럼 이렇게 만들어진 여러개의 siRNA를 한꺼번에 동물한테 주입해야하는지 각각 따로 주입해서 어느것이 잘되는지 효과를 봐야하는거지요. 두 방법다 필요할꺼같은데. ...
답변 0  |  2007.05.11
Q. siRNA 어디서 구입하면 될까요..?
실험을 처음으로 준비하려고 합니다. 일단 어디에서 siRNA를 구입해야 하는지 궁금합니다. 그리고, 구입시 or 실험할때 어떤 주의할 점이 있을까요. transfection은 일반적으로 쓰는 시약들 (Fugene이나 ...
A.  siRNA에서 순서만 섞어야 제대로라고 하던데 blast 로 negative siRNA 가 다른 gene 건드리는지 확인하셔야 합니다 시약은 일반적으로 쓰는 것들 중에 RNAi 가 가능하다고 나와있는 것들도 있고 RNAi 전용으로 ...
답변 3  |  2007.08.24
Q. siRNA target sequence UTR 부분도 포함되나요?
지금까지 siRNA 실험을 하면서 CDS 부분만 서치해서 실험을 했었는데요 혹시 UTR 부분을 target 했을때도 그에 상응하는 유전자의 발현이 다운되나요? 갑자기 혼란이 찾아와 고수 선배님들의 코멘트 ...
A.  네. UTR에 붙어서 조절하는 miRNA들도 있습죠.. siRNA도 거의 당연히 먹겠죠
답변 1  |  2007.08.09
연구윤리정보센터 검색
ZEUS 활용장비 검색
NDSL(논문/특허/보고서) 검색
한국연구재단(성과/보고서) 검색
e브릭몰 검색
이산화탄소배양기(CO2 incubator)
MCO-20AIC | 조선대학교 산학협력단 | 2003.12.30
고성능 서버 시스템(HPC SERVER 96Core SYSETM)
모델명 없음 | 서울대학교 산학협력단 | 2011.07.25
실시간 인기 검색어
주제 추천
rna protein
230/260 ratio 1
cell counting 7
ecl 29
생물학연구정보센터(BRIC)  |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
우 37673 경북 포항시 남구 청암로 77 POSTECH 생물학연구정보센터
Copyright © BRIC. All rights reserved  |  문의 member@ibric.org
트위터 트위터   페이스북 페이스북   유튜브 유튜브   RSS서비스 RSS
에펜도르프코리아 광고