[DEBUG-WINDOW 처리영역 보기]
서비스바로가기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 회원가입   로그인
BRIC홈
검색어 자동완성
실험복 제공
스폰서배너광고 안내  배너1
통합검색
동향
한빛사
Bio일정
VOD
실험
Bio마켓
BioJob
커뮤니티
농수식품
생물종
/
외부협력검색
카테고리  1차  2차
검색범위  
기간설정   ~
실험Q&A    148건 정확도순 날짜순
Q. 16S rRNA vs DNA??
차이가 무엇인지요? 16S rRNA가 rDNA로 전사되는 ... 추출한 후에 RT를 하고 16S rRNA를 target으로 Real Time PCR을 하면 Bacterial RNA가 정량할 수 있을까요?? 뭔가 기본적인 부분을 제가 모르고 있다는 느낌이 들어서 ...
A.  16S rRNA가 타겟이 아니라 16S rRNA 유전자가 타겟입니다. ii ... 유전자를 PCR 한겁니다. 16S rRNA 유전자는 모든 세균에 다 존재하며 universal primer로 모든 세균의 16S rRNA 유전자를 다 detect할 수 있습니다. ...
답변 2  |  2010.09.01
Q. 16S rRNA에 관하여
터질꺼 같습니다. 16S rRNA를 이용한 primer design에 ... PCR을 하고싶은데 16S rRNA를 이용한 primer를 사용했을때, 분리동정이 되지 않을 꺼 같아서요. 전문가 분들에게 조언을 구하고 싶습니다 ...
A.  추가적으로 말씀드리면 Bacillus cereus group은 16s rRNA 염기서열로 구분 못합니다
답변 3  |  2019.01.23
Q. 16S rRNA 시퀀싱 결과 해석 방법
안녕하세요. 16S rRNA 시퀀싱 결과를 해석하는 ... 위해 분석기관에 16S rRNA 시퀀싱 분석을 의뢰하였고, NBCI의 Blast통해 genebank database 중 어느것과 일치하는지까지 결과를 받았습니다. 그러나 문제는 ...
A.  큐레이션된 database가 있는 데요...greenenegens, silva, chunlab-ez taxon등... 쉽게 chunlab eztaxon검색하셔서 한번 해보세요.
답변 2  |  2017.12.28
Q. 16s rRNA 질문입니다..너무 답답하네요
전 교수님이 16s rRNA를 통해 bacterial ... 이해가 가지 않습니다. 16s rRNA는 종마다 보존되어 있다고 하는데, 어떻게 보존된 것을 가지고 서로 다른 종 간에 구별을 하는 건가요? 이게 같은 종 사이에는 ...
A.  일반적으로 16s rRNA가 구조적으로 유지되는 부분이 있고, 변화되는 부분이 있습니다. 아직 동정되지 않은 균주의 경우 구조적으로 유지되는 conserved region에서 forward & reverse primer를 잡죠. 물론 그 ...
답변 1  |  2007.10.23
Q. 16s rRNA 염기서열 분석관련 질문드립니다.
나타날 경우 이것도 16s rRNA 염기서열 alignment에 ... 건가요? 두번째는 16s rRNA 염기서열을 분석하는 과정에서 27f와 518r의 특정부위가 중복된 peak 이 뜨는데... 그 두 시그널이 서로 다른 높이를 보입니다. ...
A.  F/R primer에서 증촉되는 부분을 확인하기 위하여 그 바깥쪽의 부분을 primer로 만들었기 때문에 읽혀진 부분만 비교해도 동정하는데 문제는 없습니다. 그리고 염기서열 분석 시 각 염기의 시그널의 높이 ...
답변 5  |  2019.01.22
Q. 16S rRNA- Real Time PCR
정량하기위해 16S rRNA을 타겟으로 Real Time PCR을 ... iv) product가 16S rRNA이기 때문에 가능한건 가요?? 개념이 잘 서지 않습니다.ㅠ;; 결) Real Time이 conventional PCR에비해 더 sensitive하기 때문에 저 또한 bacteria를 ...
A.   RNA를 추출하면 16S rRNA가 포함되어 있을테고 1 ... 정확히는 모르겠지만 16S rRNA의 DNA 시퀀스이기 때문에 genomic DNA라고 되어 있는 게 아닐까요. 그게 그거일수도 있지만 시퀀스 올린 사람들이 RT 안하고 ...
답변 2  |  2010.01.21
Q. 16S rRNA- Real Time PCR
정량하기위해 16S rRNA을 타겟으로 Real Time PCR을 ... iv) product가 16S rRNA이기 때문에 가능한건 가요?? 개념이 잘 서지 않습니다.ㅠ;; 결) Real Time이 conventional PCR에비해 더 sensitive하기 때문에 저 또한 bacteria를 ...
답변 0  |  2010.01.18
Q. 16S rRNA
) 16s rRNA를 분석하는건데 왜 DNA를 ... DNA가 전사되서 16s rRNA로 바뀌고 그걸 시퀀싱하는가요? 2) PCR를 하고 cycle sequencing을 하던데 pcr은 DNA수를 증폭하는거인데 cycle sequencing은 pcr를 이용한 sequencing을 ...
A.  말하는 실험은 16s rRNA gene 시퀀싱을 짧게 ... 시퀀싱 하지만 짧게 16s rRNA 시퀀싱이라고 부르죠 그리고 시퀀싱의 정확도를 높이기 위해서는 내 타켓 DNA가 깨끗하게 있을때 잘되기 때문에 PCR로 target DNA를 ...
답변 2  |  2018.11.16
Q. bacteria 16S rRNA -도와주세요~ㅠ
정량하기 위해서 16S rRNA를 타겟으로 Primer를 ... 제작에 사용했던 16S rRNA partial sequence의 accession Number는 AY593991 입니다. primer는 sense : GCAACTCGCCTGCATGAAG anti-sense : GAGAATACGTTCCCGGGTCTT 였습니다. 도와주세요 ...
답변 0  |  2010.01.28
Q. 16s rRNA universal primer제작에 대한 질문.
제가 16s rRNA universal primer제작할려는데, 아무것도 모르겠네요~ 우선 그 종의 16s rRNA유전자 시퀸스를 알아본 다음 그 중 상보적인 서열의 프라이머 를 짜면 되는지? 답변 부탁드립니다. ㅠㅠ
A.  가장 정확하고 좋은 방법은 선행연구자들의 방법을 따라 하는것입니다. 논문을 보고 적정 실험방법을 택해 프라이머를 똑같이 만드세요...
답변 1  |  2007.10.17
에스엘에스바이오
외부협력검색
연구윤리정보센터 검색
ZEUS 활용장비 검색
NDSL(논문/특허/보고서) 검색
한국연구재단(성과/보고서) 검색
e브릭몰 검색
미생물분석기(Microbiology indentification system)
6890N | 국립식량과학원 | 2001.11.05
균동정시스템(Microbial ID System)
MicroSEQ Rapid ID System | (재)경북바이오산업연구원 | 2013.05.30
실시간 인기 검색어
western blot 1
pcr 5
cell
cell counting 1
dmso 1
위로가기
생물학연구정보센터(BRIC)  |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
우 37673 경북 포항시 남구 청암로 77 POSTECH 생물학연구정보센터
Copyright © BRIC. All rights reserved  |  문의 member@ibric.org
트위터 트위터   페이스북 페이스북   유튜브 유튜브   RSS서비스 RSS
에펜도르프코리아