[DEBUG-WINDOW 처리영역 보기]
서비스바로가기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 회원가입   로그인
BRIC홈
검색어 자동완성
물리적 거리두기 실천
스폰서배너광고 안내  배너1 배너2 배너3 배너4
LABox-과학으로 본 코로나19 (COVID-19)
통합검색
동향
한빛사
Bio일정
VOD
실험
Bio마켓
BioJob
커뮤니티
농수식품
생물종
/
외부협력검색
카테고리  1차  2차
검색범위  
기간설정   ~
'Primer' 관련 검색광고입니다.
NEB (New England Bio labs) 한국총판 필코리아입니다. 저렴하고 빠른 배송으로 고객의 연구비와 시간을 절약해드립니다. 전국 어디서나 주문하세요. T:02-2105-7020, F:02-2105-7025, mail: info@philekorea.co.kr
실험Q&A    1,156건 정확도순 날짜순
Q. 프라이머 제작
제한효소를 삽입하여 바로 클로닝에 들어갈려고 하는데.. 프라이머를 제작할때 제한효소를 제외하고 결합한 부위의 티엠값을 위주로 하는게 맞는지요? 저희 랩에서 바이오 메트라 피씨알 기계를 ...
A.  제한효소부위는 제외하고 결합부위의 Tm을 기준으로 하는게 맞겠네요. 따라서, Tm=60~61도이므로 annealing Temp.를 56~57도 정도로 조건을 맞추시면 될듯 싶네요.
답변 1  |  2006.03.21
Q. msDNA프라이머제작
잘 모르겠습니다. 그후에 증폭산물이 100bp이상이 되도록 프라이머를 짜라고 하는데.... 어디서부터 뭘해야할지 막막해서 글 올려봅니다. 많은 조언 부탁드릴게요.. 질문 요약.. 1.클로닝후 ...
A.  정리해서 얼라인 돌리셔도 되요.. 참고하시고요.. 프라이머는 MS영역(gt반복서열)을 포함해서 앞뒤로 100bp 읽히도록 잡으시면 됩니다 ...
답변 1  |  2008.04.02
Q. 종료 코돈이 없는 DNA 를 플라스미드에 삽입할때요..
200 개 까지의 아미노산에 대한 DNA 를 넣어야 하는데 이경우 프라이머를 짤때 원래 앞뒤에 플라스미드의 제한효소 처리위치와 동일한 시퀀스를 첨가해줘야 하는데 종료코돈이 없다면 단백질에 대한 DNA ...
A.  목적 단백질 만을 생산하고 중단시킬경우 R/E-ATG-gene-Stop-R/E순서로 하면 됩니다. 발현 vector에 넣을 경우는 보통 vector에서 stop 코돈을 제공하는 경우도 많기 때문에 vector의 stop 코돈을 사용할 경우는 R/E ...
답변 1  |  2009.03.11
Q. Primer 제작할때 leading or lagging strand
forward나 reverse를 다르게 해 줘야 하나요? 최근에 디자인 한 프라이머가 안 되길래 혹시 포워드와 리버스를 반대로 해서 증폭이 안되서 해서요. 그러니까 (-> 증폭타겟 <-) 가 아니라 ( <- 증폭타겟 -> ) ...
A.  서열상 5' --> 3'을 확인해 보시면 쉽게 알 수 있을 겁니다. Lagging 이나 leading strand는 DNA복제시의 문제일뿐 DNA는 5' --> 3' 방향만 확인하면 됩니다. 역시 primer도 5' --> 3' 방향이므로 가지고 계신 DNA서열과 ...
답변 4  |  2009.07.17
Q. 씨젠 프라이머 합성
씨젠에서 사용하는 ACP primer를 사용하려 합니다. 문의한 결과, 회사에서는 제작 해주지 않고.. 어떻게 만드는지 말씀해 주시더라구요 그런데.. polydeoxyinosine을 첨가해야 하는데.. 국내 또는 외국에 ...
A.  inosine 코드는 I입니다. 그리고 5말단에 20nt 3말단에 10nt 정도 디자인해주시고.. 중간에 5mer가 i로 되어있으면 됩니다. atgctgatcgatgtttagctggatiiiiiatgctgtgaa 그리고 디자인을 어떻게 하느냐에 따라 피씨알 결과 ...
답변 1  |  2011.01.07
Q. 프라미어 희석 도와주세요.
제가 주문한 프라이머가 아니라서 계산이 잘 안됩니다. 프라이머에 적힌걸 보니 MV= 6285, 31OD=174nm=1.10mg 이라고 되어있습니다. 이것을 10pmol/uL 로 희석하고 싶은데요. 어떻게 해야하죠?
A.  어디서 주문하셨나요? bioneer? 저희는 항상 bioneer에서 주문하는데 primer 표면에 volume for 100pmoles/ul= ***ul 이렇게 적혀있습니다. 즉 100pmole/ul를 만들고 싶으면 primerdp NFW ***ul를 넣어서 쓰죠.
답변 4  |  2011.10.18
Q. PCR 프라이머 질문 드립니다.
NC 그룹에서 나오긴 했습니다만... 매번 실험 때마다 40개 프라이머를 그때그때 섞어 쓸 수도 없고,,, 포워드 따로 리버스 따로 그렇게 믹스하면 좀 나을런지,, ...
A.  혹시 여러개를 믹스한 프라이머만 젤에 로딩했을때 밴드가 나오면 프라이머들이 어떤 반응을 일으켜서 이렇게 된 거라고 생각 할 수 있을까요?
답변 1  |  2014.03.14
Q. 이름붙은 프라이머 질문
이름을 붙이는 경우는 어떤 경우인건가요? 2. 이름이 있는 프라이머를 따로 모아놓은 사이트가 있나요 ...
A.  본인들이 직접 디자인하고 처음 사용했을 경우, 그 프라이머를 후속 연구자들도 쉽게 인용하여 사용하도록 따로 이름을 붙여 놓는 경우가 있는 듯 합니다. 말씀하신 예시도 Reference의 protocol을 대충 ...
답변 1  |  2016.10.21
Q. 시퀀싱 프라이머의 방향  |  첨부파일 첨부파일
site : 5-gta aaa cga cgg cca gt 1. 제가 궁금한 것은 시판되는 프라이머의 시퀀스와 제 벡터를 비교하여 보면 제 생각에 M13 reverse가 forward 같고 M13 forward 라고 나와있는 것이 reverse 같은데 왜 vector map 에는 ...
A.  . 제가 궁금한 것은 시판되는 프라이머의 시퀀스와 제 벡터를 비교하여 보면 제 생각에 M13 reverse가 forward 같고 M13 forward 라고 나와있는 것이 reverse 같은데 왜 vector map 에는 이름이 저렇게 표기된 ...
답변 4  |  2008.07.03
Q. coventional PCR시 프라이머 최종 농도...
900nM(0.9pmol)로 대부분 하더군요. 그렇다면 일반 PCR에서도 프라이머 최종농도를 real time PCR에서와 비슷하게 높여서 실험해도 되지않나요? 꼭 논문에 나와있는 농도인 0.4pmol이 되게 해줄 필요 없지 않나요 ...
A.  이게 도움이 되실런지 모르겠네요..... 바이러스 및 병원성 세균을 검출하는 PCR 진단 키트를 개발할때..... 최적 primer 농도를 확인하게 됩니다. 그이유는 primer의 농도가 너무 작으면 target을 검출하지못 ...
답변 2  |  2017.02.23
이화여자대학교
외부협력검색
연구윤리정보센터 검색
ZEUS 활용장비 검색
NDSL(논문/특허/보고서) 검색
한국연구재단(성과/보고서) 검색
e브릭몰 검색
상보적디옥시리보핵산합성도구(DNA synthesizer)
MerMade-4 | 국립축산과학원 | 2007.09.07
전자동전기영동장치(Automated Electrophoretic Separator...
LabChip GX II | 한국원자력연구원 | 2011.09.21
위로가기
생물학연구정보센터(BRIC)  |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
우 37673 경북 포항시 남구 청암로 77 POSTECH 생물학연구정보센터
Copyright © BRIC. All rights reserved  |  문의 member@ibric.org
트위터 트위터   페이스북 페이스북   유튜브 유튜브   RSS서비스 RSS
머크