[DEBUG-WINDOW 처리영역 보기]
서비스바로가기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 회원가입   로그인
BRIC홈
검색어 자동완성
랩박스 - 형광 이미징의 모든 것
스폰서배너광고 안내  배너1 배너2 배너3
과학으로 본 코로나19 (COVID-19)
통합검색
동향
한빛사
Bio일정
VOD
실험
Bio마켓
BioJob
커뮤니티
농수식품
생물종
/
외부협력검색
카테고리  1차  2차
검색범위  
기간설정   ~
'NGS' 관련 검색광고입니다.
자동 Next Generation Sequencing 라이브러리 준비는 피펫팅 오류를 최소화해 재현 가능한 결과를 보장하고 생산성을 향상시킵니다.제품문의 T)1577-4395
실험Q&A    499건 정확도순 날짜순
Q. 염기서열 자동으로 세어주는 프로그램이 있나요?
세는데 너무 힘드네요;; 눈이 빠져버릴듯 ㅠㅠ 염기서열을 세는 프로그램이 있다고 들었는데 프로그램 이름이랑 구할 수 있는 방법 좀 알려주세요 예를들어 ccaatgtcagtatacccatagccggt 이런 서열을 넣으면 ...
A.  grep 이나 agrep 을 써서 하고 있지요. agrep -0 -c NNNNNNNNNNNN test_file.fastq -0 는 0 mismatch, -c는 카운트한 숫자만 표시하라는 옵션, 안하면 염기 서열과 빨간 타겟 염기가 표시되어 스크린에 나옵니다. 길---게.... ...
답변 5  |  2006.07.01
Q. 염기서열 비교분석  |  첨부파일 첨부파일
표현해야할지 모르겠어요. phydit에서 보면 해단균주의 염기서열중 몇번째 bp라고 알려주긴하는데... 글로 풀어서 가져오라고 하시는데 난감하네요. 한가지더 질문 드리자면 N값이나 블랭크된 부분도 ...
A.  어려움을 충분히 이해합니다. 저도 전공자도 아닌 사람이 누구 가르쳐 주는 사람도 없이 거의 독학으로 했거든요. 가까이 계시다면 직접 가르쳐드리고 싶기까지 하네요. 아마 기초적인 부분만 시퀀싱 ...
답변 4  |  2011.06.27
Q. protein sequence와 염기서열에 관해 질문드립니다~
기입해도 되는지.. 아니면 NCBI에서 해당 protein의 염기서열을 찾아야 하는지 잘 몰라서 질문드립니다 ㅜㅜ 간단한 것도 잘 몰라서 부끄럽네용 ㅜㅜ 답변 부탁드립니다 ...
A.  벡터를 삽입한 세포를 배양하고 recombinant protein을 추출정제 하셨을테니 삽입된 벡터의 염기서열을 알고계신분한테 정보를 요청하시는게 좋겠네요
답변 1  |  2016.08.25
Q. 특정 균주만 !! 가진 염기서열을 찾고자 하려고 합니다...
제작같은것이 아닌 말그대로... 저 균주만 가지고 있는 염기서열을 찾으려고 하는데, 어떤 프로그램을 사용하면 될까요? A균주 염기서열~~~~~~~~~~ B균주 염기서열~~~~~~~~~~~~ . . . 이런식으로 비교해놓고 ...
답변 0  |  2015.01.30
Q. 전체 염기서열을 비교해볼수있는 프로그램은 뭐가 있나요???처음 실험하는 학생입니다ㅠㅠ도와주세요ㅠㅠㅠ
사이즈 이상 부분만을 찾아내면 됩니다. 그냥 생각해보면 염기서열 쭉 병렬로 띄워두고 공통된부분과 다른부분이 표시되는 그런 프러그램도 있을것같은데.. 가능한 프로그램이있을까요??? 도와주시면 ...
A.  저도 전공은 아닙니다. 지극히 사견을 적어 봅니다. NGS와 같은 full 시퀀싱을 대행하셔서 진행하셨거나 랩에 장비가 있어 진행하셨다면... 대행업체와 시퀀스 기계 업체에 연락해 학술 지원을 받아 보 ...
답변 2  |  2015.01.31
Q. 염기서열분석회사 추천
수가 없어서 답답하네요. 이런 경우 해결방법이나 유전자 염기서열분석을 잘 하는 회사를 알고 계시다면 추천부탁드립니다 ...
A.  염기서열 분석을 전문으로 하는 회사는 국내에 많이 있습니다. 저는 주로 마크로젠(www.macrogen.com)을 이용하고 있는데, 만족도가 높습니다. 물론 분석 시료의 차이, 만족도에 있어 개개인의 차이 등이 ...
답변 2  |  2012.07.30
Q. 염기서열 분석 및 계통수 작성
오랜만에 질문드립니다. 세균의 특정 단백질에대한 염기서열을 분석(500bp정도)했는데요 .. 250-252bp 염기에서 중복된 염기 발견되어 NCBI에 검색 해봤더니 과거 자료에서 동일한 결과를 볼 수 ...
답변 0  |  2013.06.19
Q. 염기서열분석에 관해 질문드립니다
DNA 의 염기서열을 검색해볼수있잔아요? 검색해서 나오는 염기서열을 보니 그냥 왼쪽에 몇번쨰인지 나타내는 숫자랑 오른쪽에는 염기만 일렬로 쭉 써있고 5'이나3'같은 정보는 알수 없는 건가요 이것만 ...
A.  reverse complement로 바꾼 서열과 같을 겁니다. 그리고 참고로 염기서열 위에 보면 등록정보라고 해야 하나.. FEATURES 부분에 CDS라고 되어 있는 게 있을텐데 coding sequence를 말하며 실제로 코딩되는, ...
답변 4  |  2009.05.28
Q. DNA 염기 서열을 논문에 사용하고자 합니다
써 있고 어디는 밑줄 쳐져 있고 어디는 네모로 표시하고 염기서열 아래에는 아미노산 서열들 적혀있고... 기타 등등.. 여러가지 표시를 하던데 이런 표시들은 워드에서 직접 표시를 하는 것인가요? ...
A.  느림보님 답변 감사합니다 이런 기능도 있었군요^^ 정보 감사합니다 ^^
답변 6  |  2012.09.04
Q. 클로닝으로 염기서열 어떻게 확인할 수 있는건가요?
아는 경우에만 사용 가능한 방법이잖아요 그런데 그 염기서열을 알아내기 위한 방법이 유일하게 클로닝 뿐이라고 하던데 클로닝으로 어떻게 알 수 있는건가요? 원하는 유전자가 어디 있는지 어떻게 ...
A.  염기서열을 알아내는 방법은 시퀀싱입니다. 원하는 유전자를 아는 방법은 제한효소 부분을 검색해보심이 좋겠네요.
답변 4  |  2016.04.29
라이브셀인스트루먼트
외부협력검색
연구윤리정보센터 검색
ZEUS 활용장비 검색
NDSL(논문/특허/보고서) 검색
한국연구재단(성과/보고서) 검색
e브릭몰 검색
다량 유전자 염기서열 분석기(NGS(Next Generation Se...
454 Sequencing System | 국립암센터 | 2012.04.24
자동유전자염기서열분석기(AUTOMATIC GENETIC ANALYZE...
3130XL Genetic Analyzer | 한국원자력연구원 | 2006.11.23
실시간 인기 검색어
생명과학실험
mtt assay 43
동물 10
pcr 1
230/260 ratio
위로가기
생물학연구정보센터(BRIC)  |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
우 37673 경북 포항시 남구 청암로 77 POSTECH 생물학연구정보센터
Copyright © BRIC. All rights reserved  |  문의 member@ibric.org
트위터 트위터   페이스북 페이스북   유튜브 유튜브   RSS서비스 RSS
에펜도르프코리아