[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 동향
스폰서배너광고 안내  배너1 배너2 배너3 배너4
피부 마이크로바이옴 연구 동향
전체보기 Bio통신원 Bio통계 BRIC View BRIC이만난사람들 웹진(BioWave)
조회 5579  인쇄하기 주소복사 트위터 공유 페이스북 공유 
[실전 실험 프로토콜 101] #8. 유전자 발현과 microRNA 발현 측정
생명과학 세오 (2021-12-27)

PCR은 최종 산물을 이용하는 반면에, Real-time PCR (RT-PCR) 혹은 qPCR은 실시간 (real-time)으로 PCR product의 증폭을 모니터 할 수 있습니다 (노트 1). 다시 말해 qPCR은 정량 (Quantitation)이 가능합니다. PCR 1 사이클 (cycle)이 진행되면 product가 이론상 2배씩 증가합니다 (2^N). qPCR에서 정량을 모니터 하기 위해서 형광 (SYBR과 TaqMan probe)을 이용합니다 (그림 1, 노트 2). qPCR은 타깃 유전자 시퀀스가 필요해서 Microarray 혹은 RNA-Seq 후 관심 있는 유전자 발현 혹은 microRNA 발현을 확인하는 데 사용합니다.

프라이머 (Primer) 디자인

qPCR은 정량을 모니터 하는 것이 목적이기에 타깃 사이즈를 70-200 bp 정도로 합니다. 프라이머를 디자인하는 간단한 방법은 이미 알려진 프라이머 디자인 사이트 중에서 이용하면 됩니다 [PrimerBank; 출처 1]. 개인적으로는 직접 프라이머 디자인을 하는 것을 선호하는데, 직접 프라이머를 디자인할 때 아래의 내용을 주의하며 디자인을 합니다. 프라이머가 붙는 위치의 엑손 (exon)이 스킵핑 (skipping)이 일어나지 않아야 합니다. 프라이머가 붙는 위치의 엑손이 스킵핑이 일어나는 아이소폼 (isoform) 일 경우는 모니터에서 제외되기 때문에 타깃 유전자의 전체 발현량을 정확하게 측정할 수 없습니다. 또한, 5′ 프라이머와 3′ 프라이머가 붙는 위치가 같은 엑손 안에 위치하지 않게 디자인을 해야 합니다. 그렇지 않으면 지노믹 DNA (genomic DNA, gDNA)가 오염된 샘플의 경우는 gDNA도 함께 검출되어서 올바른 결과를 얻을 수 없습니다. 이를 방지하기 위해 DNase I을 처리하고, 나아가 프라이머를 디자인할 때 엑손 정크션에 위치하도록 프라이머를 디자인하면 도움이 됩니다. 예를 들어, 프라이머가 엑손이 스킵핑이 일어나지 않는 연속된 두 개의 엑손이 걸치게끔 프라이머를 디자인합니다 [출처 2].


그림 1. SYBR vs. TaqMan [출처 3].

mRNA 정량

mRNA 정량을 할 때는 total RNA를 Trizol을 이용해서 추출하고, SYBR를 사용해서 qPCR를 합니다. Negative 컨트롤로 No template control (NTC: 프라이머 다이머 (dimer) 생성 컨트롤), No Reverse-Transcriptase control (NRT: gDNA 오염 컨트롤)를 사용합니다. 20 μl Reaction에 cDNA (complementary DNA) template을 1:20으로 희석한 다음 1.5 μl (1-100 ng cDNA)를 사용합니다. cDNA를 1:20으로 희석해서 사용하는 이유는 qPCR에서 cDNA를 만들 때 사용된 다른 시약들의 영향을 줄이기 위해서입니다. qPCR를 마친 뒤 샘플을 젤에 로딩해서 예상되는 사이즈에 나오는지, 프라이머 다이머가 나오는지, 다른 예상 밖의 사이즈가 나오는지 확인하는 과정을 거칩니다. Housekeeping 유전자 (예를 들어, β-actin)를 사용합니다. 

microRNA 정량

Mature microRNA (miRNA) 경우에는 miRNeasy Micro Kit (Qiage)과 TaqMan miRNA assays (Life Technologies)를 이용해서 정량합니다. Internal 컨트롤 (예를 들어, Sno202)를 사용합니다. miR-107 (AGCAGCAUUGUACAGGGCUAUCA)과 miR-103 (AGCAGCAUUGUACAGGGCUAUGA)은 빨간색 한 부분만 차이가 나지만, TaqMan miRNA assays를 이용해서 miRNA-107과 miRNA-103를 구별해서 정량이 가능합니다.

Delta-delta Ct 방법

그림 2. Delta-delta Ct 방법. GOI: Gene of Interest, Ref: reference gene. A: Treated sample, B: Untreated sample.


qPCR 분석

qPCR를 실행하면 Ct 값을 얻게 되는데, 이 Ct 값은 DNA 양과 반비례합니다. 다시 말해, Ct 값이 작다는 의미는 처음 DNA양이 많아서 증폭을 적게 시켜도 타깃  DNA가 검출된다는 뜻입니다. qPCR를 분석을 할 때 Delta-delta Ct 방법을 사용합니다 [그림 2, 출처 4]. 다음 연재에서는 연재 7 (웨스턴 블랏)에 이어서 "면역 침강 (Immunoprecipitation)"에 대해 소개하겠습니다.


  1. RNA에서 cDNA를 만들어서 PCR을 하는 방법을 Reverse-Transcription PCR 합니다. 이를 줄여서 RT-PCR이라고 합니다. 혼동을 줄이기 위해 이글에서는 Real-time PCR를 qPCR로 표기했습니다.
  2. SYBR은 DNA에 비특이적으로 끼어 들어가 형광을 냅니다. 따라서 SYBR 경우에는 타깃 product가 아니어도 형광을 낼 수 있습니다. 이에 반해 TaqMan probe은 Quencher를 이용하여, PCR 합성이 진행되면 형광을 냅니다.


  1. https://pga.mgh.harvard.edu/primerbank/
  2. https://www.ibric.org/myboard/read.php?Board=news&id=330976&Page=1
  3. https://www.smobio.com/faq-real-time-pcr
  4. https://toptipbio.com/delta-delta-ct-pcr/
  추천 2
인쇄하기 주소복사 트위터 공유 페이스북 공유 
세오 (필명) (Cincinnati Children’s Hospital Medical Center)

논문에 나온 실험을 따라서 하고 싶어도 논문에 실험 절차가 너무 간략하게 소개되어 있거나,  자세한 설명이 없어서 실험을 따라 하기가 어려운 경우가 종종 있습니다. 이럴 경우 '같은 실험실 혹은 주위 실험실에서 실제로 유사한 실험을 한...

다른 연재기사 보기 전체보기 >
[실전 실험 프로토콜 101] #16. 올리고 오버랩 클로닝 (Oligo overlap cloning)
간혹 실험에 사용할 플라스미드 (plasmid)의 Multiple Cloning Site (MCS)에 실험자가 원하는 제한효소가 없는 경우도 있습니다. 이번 연재에서는 플라스미드에...
[실전 실험 프로토콜 101] #15. G2 checkpoint assay
G2 체크포인트 (checkpoint)는 DNA가 손상됐을 때 세포가 mitosis (유사분열)로 들어가지 못하게 하고, 유전체 보존 (genome integrity)를 보하는 데...
[실전 실험 프로토콜 101] #14. 쥐에서 일차 간세포(primary hepatocytes) 추출 방법
일차 간세포 (primary hepatocytes)는 기능적 특성에서 in vitro 간세포보다 in vivo 간세포와 더 유사합니다. 예를 들어, 일차 간세포는 간 생체 검사와...
본 기사는 네티즌에 의해 작성되었거나 기관에서 작성된 보도자료로, BRIC의 입장이 아님을 밝힙니다. 또한 내용 중 개인에게 중요하다고 생각되는 부분은 사실확인을 꼭 하시기 바랍니다. [기사 오류 신고하기]
  댓글 0 댓글작성: 회원 + SNS 연동  
첫 댓글을 달아주세요.
동향 홈  |  동향FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
필코리아테크놀로지 광고