[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 sale 회원가입   로그인
BRIC홈 실험
써모피셔 사이언티픽
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
겨울철의 실험실 안전 점검
전체보기 안전점검 논문교환 LABox
 전체 > Molecular Biology-DNA > PCR/RT-PCR/Q-PCR
조회 576  스크랩 인쇄하기 주소복사 트위터 공유 페이스북 공유 
질문 primer 제작시 시작코돈은 안넣어도 되나요 ?
알링피맏명(대학생)  | 11.19 13:26

GAGGATTGCTTTCTCCATGTCTCCGTTTTTGAGGATTGCTTTCTCCAGTTTTGA

GATGGACCCAGGACTTGCCTATCATGAAGAAGTGATTTCTCCAGT

서열이 이렇다고 가정을 하면 앞부분에 보면 GAGGATTGCTTTCTCC하고 ATG해서 시작 코돈이 있는데 primer을 제작할때 ATG안넣어도 되나요 ?

 

그리고 primer이 붙은 부분은 증폭이 되나요 ? 아니면 시작점만 지정하기 때문에 증폭이 되지 않나요 ?

#pcr
 
#pirmer
답변하기
답변 본 정보는 네티즌에 의해 작성된 정보로, 내용 중 중요하다고 생각되는 부분은 추가적인 사실 확인을 반드시 하시길 바랍니다.
대왕개구리강시  |  11.19 13:40  
채택답변: 질문자가 채택한 답변입니다.

PCR 의 목적에 따라서 ATG를 넣거나 뺍니다.

primer 까지 포함해서 증폭이 되지요.

PCR에 대해서 공부를 조금만 하세요.

구글에가서 PCR 이미지만 몇개 보아도 이해가 될겁니다.

1212  |  11.21 01:22   

PCR Product로 무엇을 할것이냐에 따라 다르겠지요

 

PCR Product를 백터에 넣어서 특정 단백질을 Overexpression 시킬 목적이라면 Start codon이 필수적으로 들어가야 겠지요.

 

아시겠지만 혹시나 싶어 말씀드리면 단순히 PCR만 한다고 하면 Start codon의 유무는 아무 영향이 없습니다.

답변하기
할인행사 광고 검색광고
인성크로마텍 인성크로마텍
세계에서 가장 빠르고 간편한 16S NGS Library Prep 키트 (데이터 분석 리포트 포함) (12.26까지)
비투바이오 비투바이오
B2BLACK FRIDAY: Sorenson, VOLO 등 실험실 소모품 2020년 마지막 할인! (12.31까지)
필코리아테크놀로지 필코리아테크놀로지
Lucigen Competent cell 20% 할인행사 / 단백질도 BiOptic Qsep series /.. (12.8까지)
바이오닉스 바이오닉스
2020년 바이오닉스는 TECAN의 공식 파트너로 런칭! (런칭 프로모션 진행중) (1.24까지)
에펜도르프코리아 에펜도르프코리아
Eppendorf 2020 하반기 프로모션 행사 : 실험실 필수품 피펫,원심분리기,PCR장비,초저온냉동고,M.. (12.31까지)
프리미엄 등록안내
외부제휴사 광고 AD
e브릭몰
sale
5/6  좌우
555,000
158,40047,600
143,800136,700
924,000
139,000132,100
136,000129,200
22,7006,900
739,000702,100
887,200266,200
50,00015,000
230,000
793,400753,800
245,20073,600
379,000
136,000
80,40024,200
201,30060,400
47,20044,900
238,70071,700
79,50075,600
242,400230,300
309,000
388,500116,600
246,60074,000
최근등록   더보기 >
Avogadro 프로그램의 파일을 pdb 파일로 전환하는 방법   12.04
미생물 멸균에 관해서 질문 드립니다.   12.03
MTT assay 시 시료 녹이는 용매   12.03
western blot wet transfer이 안됩니다   12.03
Gluco-oligosaccharide 판매처 아시는분 있으신가요?   12.03
hplc gradient 설정 조언 부탁드립니다.   12.03
관상동맥질환, 혈액응고장애 모델동물 질문입니다.   12.03
오토클레이브 청소   12.03
emb배지 초록색   12.03
표준물질 조제   12.03
제품평가
[바이오탭스]
Mini Magnet Virtical Electrophoresis System
바이오탭스
모집인원: 15명
모집기간: ~12/9까지
신청조건: BRIC 회원
평가자 혜택

- 참가자 전원 2만원 상품권 제공
- 평가후 평가제품 구매 시 알루미나 플레이트와 콤 5개 제공
- 우수평가자 3명에게 5만원 상품권 추가 제공

제품평가자 모집중
최근답변자 우수답변자
알생공생공생

대왕개구리SPEED

알꼬꼬옹티

알깜빠뉴

개구리A'ANE

올챙이가나다라abcd

꽃개구리Applied_Mi..

올챙이실험실뵹아리

꽃개구리착한사람

개구리G.P.Ts

개구리현직백수

개구리ExDown's

개구리지냐

꽃개구리스카이

꽃개구리TX

개구리bio

실험관련연재
박은총 연재중후배에게 주고 싶은 면역학 노트
박은총(Duke University)
신코 연재중분석장비 이야기
분석장비 탐험가 (필명) ((주)신코)
Mr.S 연재중의학계의 Spectaculum: 임상시험
Mr. S (필명) (연세대학교)
에스프리 연재중실험을 해봅시다
에스프리 (필명)
곽민준 연재중랩노트
곽민준 (POSTECH 생명과학과)
이제욱 연재중생명과학자 기초체력 다지기
이제욱 (오송첨단의료산업진흥재단, 신약개발지원센터)
ZEUS
위로가기
실험 홈  |  실험FAQ  |  실험 문의 및 제안
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의 member@ibric.org
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
머크 광고