[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 회원가입   로그인
BRIC홈 실험
웨비나 모집
스폰서배너광고 안내  배너1
전체보기 안전점검 논문교환 LABox
 전체 > Molecular Biology-DNA > Gene Cloning
조회 426  스크랩 인쇄하기 주소복사 트위터 공유 페이스북 공유 
질문 클로닝 프라이머를 짜는중인데 막혀서 급하게 질문드립니다 ㅠㅠ
알ex0628(일반인)  |  07.14 17:20

스냅진 프로그램을 이용해서 프라이머를 짜다가 막혀서 이렇게 질문드립니다 ㅠㅠ 연구실에서 인턴을 하고 있는데 내일까지 해야하는데 막막하네요...

벡터는 지금 pCDH-RFP를 쓸려고 하고 타겟 gene은 XAGE1B입니다...

논문에서는 cloning site를 EcoR1과 XhoI을 사용했다고 해서 그대로 써보니까 이에 맞는 compatible restriction site가 XAGE1B에는 없네요 ㅠㅠ... 아직 학부생이라 정말 아무것도 모르는 상태에서 이런걸 해오라니까 정말 막막합니다...

 

고수님들 답변 부탁드릴게요 ㅠㅠ 감사합니다...

#XAGE1B
 
#cloning
 
#pCDH-RFP
답변하기
답변 본 정보는 네티즌에 의해 작성된 정보로, 내용 중 중요하다고 생각되는 부분은 추가적인 사실 확인을 반드시 하시길 바랍니다.

당연히 cloning에 사용하는 효소자리는 ORF 안에 없어야 합니다.

EcoRI과 BamHI으로 잘라서 vector에 넣을 때 ORF에 해당 효소자리가 있으면

ORF가 잘라지기 때문에 cloning이 불가능합니다.

ATG에서 하류로 forward primer 23mer를 기준으로 Tm을 계산해 보고

종결코돈 TAA 상류로 reverse primer 23mer를 기준으로 Tm을 계산해서

두 primer의 Tm이 비슷하게 나오고 60 ~ 65도 정도 나오면 그 서열을

primer로 사용하면 됩니다.

ATG 앞에 EcoRI, TAA 뒤에 XhoI 서열을 붙이고 T vector에 cloning했다가

pCDH-RFP에 cloning하려면 바로 PCR하면 됩니다.

T vector를 거치지 않고 pCDH-RFP에 바로 cloning하려면 PCR 증폭 후

제한효소 cut 효율을 높이기 위해서 EcoRI 앞에 3개~5개 정도 염기,

XhoI 뒤에 3개~5개 정도 염기를 랜덤하게 넣어서 primer를 만들면 됩니다.

이해가 안되는 부분은 다시 질문을 주세요.

대왕개구리SPEED  |  07.14 18:18  

 primer design하는건 아는 사람은 길어야 30분이면 하는 작업인데, 처음 배우는 입장에서는 모든 원리를 이해해야 하니 힘든 작업입니다ㅎㅎㅎ

 "Speed" 님이 과정을 세부적으로 잘 설명해 주셨는데 아마 이해가 잘 안되실 꺼예요.

한 줄 한 줄 왜 그렇게 말씀하셨는지 pcr에 대해 공부하시면서 이해하시면 아마 나중에도 크게 도움이 될 듯합니다.

개구리kakaoblack99  |  07.18 13:01  

타켓 gene의 enzyme site 유무부터 확인하셔야 할것 같습니다.

보통 vector map에 MCS site가 존재하기 때문에 그걸 참고하셔서

http://nc2.neb.com/NEBcutter2/

위 링크에서 확인해보세요~

타겟 gene에 enzyme site가 없는 MCS site 중 골라서

sequence를 넣어 primer를 제작하면 됩니다.

 

옥이  |  07.18 13:50   

gagagttaGAATTCaccATGGAGAGCCCCAAAAAGAAGAACCAGCAGCTGAAAGTCGGGATCCTACACCTGGGCAGCAGACAGAAGA
AG
ATCAGGATACAGCTGAGATCCCAGTGCGCGACATGGAAGGTGATCTGCAAGAGCTGCATCAGTCAAAC
A
CCGGGGATAAATCTGGATTTGGGTTCCGGCGTCAAGGTGAAGATAATACCTAAAGAGGAACACTGTAAA
ATGCCAGAAGCAGGTGAAGAGCAACCACAAGTTTAActcgagAAGGTTCG

gene이 짧던데 dsDNA 합성가능한 업체에 의뢰해도 큰 돈 안들이고 가능하겠네요

밑줄친 primer pair로 60oC에서 10cycle 돌리고 68oC에서 20 cycle 돌리면 ~250 bp band가 보일 것입니다.

dd  |  07.19 01:25   
답변하기
할인행사 광고 검색광고
싸토리우스코리아바이오텍 싸토리우스코리아바이오텍
피펫 3+1 & 구매 인증샷 이벤트 (10.31까지)
프리미엄 등록안내
외부제휴사 광고 AD
e브릭몰
βeta
3/6  좌우
56,70054,000
49,700
107,200102,000
123,900118,000
231,000219,000
286,700
137,600131,000
231,000219,000
218,200
180,700172,000
121,700
286,700
286,700
286,700
668,600334,000
101,90097,000
286,700
130,00065,000
79,80076,000
50,50048,000
144,900138,000
286,700
82,800
113,500108,000
최근등록   더보기 >
RNA isolation 질문입니다   08.18
RAW cell의 배양 배지와 Activation에 대해 질문드립니다!!   08.18
잎사귀내 포도당(단당류) 농도변화를 알 수 있는 실험이나 장치가 있을까요?   08.18
유전 알고리즘 도서   08.18
적상추에서 쿼세틴 추출   08.18
토양 시료 전처리 방법   08.17
토양 속 균을 보존하려면 어떻게 해야 되나요?그리고 균 배양 다른 방법이 없을까요?   08.17
TEM으로 E. coli 에서 glycogen관찰   08.17
담배 GFP 발현 관찰..   08.17
ponceasu 염색 후 membrane이 이상해요..   08.17
라이카코리아
ZEUS
위로가기
실험 홈  |  실험FAQ  |  실험 문의 및 제안
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의 member@ibric.org
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS