[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 회원가입   로그인
BRIC홈 실험
웨비나 모집
스폰서배너광고 안내  배너1
전체보기 안전점검 논문교환 LABox
 전체 > Molecular Biology-DNA > DNA Modification
조회 809  스크랩 인쇄하기 주소복사 트위터 공유 페이스북 공유 
질문 site-directed mutagenesis가 되질 않습니다...
알도오ㅏ주세요(대학원생)  |  02.08 13:48

site-directed mutagenesis를 진행중인 신입 대학원생입니다
UG 염기 두개를 AC로 바꾸는 실험을 진행중인데요 kit를 사용하지 않고 PCR로 진행중입니다

Primer design은 PrimerX site에서 진행하였고 

                                   **
    Forward: 5' CAGGTAAGCACTGAAGACTACTTTTATAAGTGTCCCAAGCG 3'
    Reverse: 5' CGCTTGGGACACTTATAAAAGTAGTCTTCAGTGCTTACCTG 3'
                                    **
     GC content: 43.90%           Location: 56-96
     Melting temp: 78.1°C         Mismatched bases: 2
     Length: 41 bp                Mutation: Substitution
     5' flanking region: 19 bp    Forward primer MW: 12617.35 Da
     3' flanking region: 20 bp    Reverse primer MW: 12590.32 Da


이렇게 제작하였고 책이나 논문 브릭에 나와있는대로 PCR을 진행하였습니다
95°C (30sec) / 95°C (30sec) 55°C(1min) 68°C(9min- template plasmid 크기가 8.5kb정도 됩니다) / 68°C (10min)

DNA (50ng) 1ul
primer F, R 각각 1ul
dNTP(200mM) 1ul
10x pfu buffer 5ul
Pfu nforte 1ul
D.W 40ul 으로 총 50ul

중간에 온도를 50~70
°C까지 바꿔서 30cycle을 돌려봐도 plasmid가 확인되지 않고 또 PCR 시간이나 조건들을 바꿔봐도 확인되지 않고 18 cycle을 돌려 Dpn1을 37도에서 1시간 처리한뒤 DH5a에 transformation을 해봐도 콜로니가 뜨지 않습니다 

또한 이것이 primer 농도의 문제인가 싶어서 125ng, 50pmol, 2.5pmol로 PCR을 돌려봐도 마찬가지입니다 ㅠㅠ

혹시 site-directed mutagenesis를 잘 아시는 분들은 조언바랍니다...
#PCR
 
#site-directed mutagenesis
답변하기
검색광고 검색광고
[정코퍼레이션] Cryogenic Barcode Labels -196℃ to +100℃
초저온 냉동(-80℃),액체질소(-196℃),액체질소증기(-150℃) 촉으로 인한 라벨 표시가 떨어짐 현상이 있는 경우에 적합하며, Deep Freezer,LN2 Tank 보관,냉동고용 식별 및 저장에 이상적입니다.
답변 본 정보는 네티즌에 의해 작성된 정보로, 내용 중 중요하다고 생각되는 부분은 추가적인 사실 확인을 반드시 하시길 바랍니다.

PCR reaction시  제 기억으론 pfu DNA polymeration rate가 0.5kb/1min로 알고 있습니다.

8.5kb라면 17분간 해야겠죠..그런데 너무 기네요...


pfu 매뉴얼 확인해보세요. 회사마다 틀릴 수도 있어요.



잘 되지 않는다면 다른 방법도 있습니다.

overlapping PCR 등등...

개구리엑스트라  |  02.08 14:02  

Pfu  증폭 후 전기영동에서 product가 보이나요?

Pfu로 증폭 하기에 너무 긴것 같습니다.

mutagenesis를 포함하는 최소한의 부분만 증폭 해서 vector에 연결하는게 더 편리 할수

있습니다.

아니면 mutagenesis를 포함하는 100 ~ 200bp를 잘라낼수 있다면 oligomer를 합성해서

diret로 fragment를 바꿔줘도 편리하게 실험 할 수도 있습니다.

대왕개구리SPEED  |  02.08 15:30  

다른 방법도 있겠지만, 좀 비싸더라도 좀 더 효율이 좋은 polymerase를 사용하시면 훨씬 쉬우실 것 같아요.
제가 있는 랩에서는 NEB Q5 HF-pol로 SDM을 하고 있는데요, 7-8 Kb 대 template도 문제없이 잘 진행하고 있습니다. Q5의 elongation rate은 Kb 당 20-30초라서 8kb도 사이클 당 약 3-4분 정도면 elongation도 끝납니다. 한 번 고려해보세요!

+) 위에 보니 nPFU-Forte taq을 사용하신다고 적어두셨는데, 해당 제품 프로토콜에는 extension 온도가 72도 권장인데, 68도 말고 72도에서도 해보셨나요?

뒷다리goviral  |  02.08 23:24  

forward와 reverse 서열이 같은 것 아닌가요?

개구리느림보  |  02.12 00:54  

정확히 MUTATION을 하고자 하는 위치가 어딘진 모르겠지만


PRIMER의 길이가 너무 깁니다.


MUTATION을 하고자 하는 부분을 중앙에 위치 시키고 


양쪽으로 15BPS가 넘어가면 PCR이 잘 안 되더라구요.


즉 길다고 잘 붙지 않습니다.


CYCLE은 18번이면 충분합니다. 


참고로 PCR 후 전기 영동으로 BAND가 보이지 않아도 TRANSFORMATION


하면 실험은 가능합니다. 

MSG  |  02.13 10:31   
답변하기
할인행사 광고 검색광고
싸토리우스코리아바이오텍 싸토리우스코리아바이오텍
피펫 3+1 & 구매 인증샷 이벤트 (10.31까지)
프리미엄 등록안내
외부제휴사 광고 AD
e브릭몰
βeta
3/6  좌우
137,600131,000
286,700
56,70054,000
101,90097,000
121,700
286,700
82,800
123,900118,000
286,700
107,200102,000
668,600334,000
113,500108,000
218,200
50,50048,000
79,80076,000
49,700
180,700172,000
144,900138,000
286,700
231,000219,000
130,00065,000
286,700
286,700
231,000219,000
최근등록   더보기 >
E.coli strain간의 차이를 해석 부탁드려도 될까요 ..   08.20
Corynebacterium glutamicum의 Deletion 실험 (SacB-Homo...   08.20
1% Formalin 만들기...ㅠㅠ   08.20
crude pheromone의 의미   08.19
항생제 감수성 검사 결과 분석 관련 질문입니다   08.19
gDNA 추출   08.19
pcr 사이클에서 궁금한 것이 있습니다   08.19
HPLC 를이용해 MDA를 측정하려고합니다.   08.19
Carbohydrate FITC labelling 질문   08.19
R2YE 배지 조제 질문입니다.   08.19
비아이코퍼레이션
ZEUS
위로가기
실험 홈  |  실험FAQ  |  실험 문의 및 제안
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의 member@ibric.org
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS