[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 회원가입   로그인
BRIC홈 실험
물리적 거리두기 실천
스폰서배너광고 안내  배너1 배너2 배너3 배너4
LABox-과학으로 본 코로나19 (COVID-19)
전체보기 안전점검 논문교환 LABox
 전체 > Molecular Biology-DNA > Sequencing
조회 5802  스크랩 인쇄하기 주소복사 트위터 공유 페이스북 공유 
질문 염기서열 fasta 파일로 만드는법
올챙이신입사원  |  2016.02.22 13:26

안녕하세요.

제가 NCBI 에서 찾은 염기서열을 fasta 파일 형식으로 만들고 싶은데요

방법을 알려주시면 감사하겠습니다.

#fasta
 
#sequencing
답변하기
검색광고 검색광고
[에펜도르프코리아] NGS 라이브러리 전처리를 간편하게 Eppendorf epMotion자동분주기
자동 Next Generation Sequencing 라이브러리 준비는 피펫팅 오류를 최소화해 재현 가능한 결과를 보장하고 생산성을 향상시킵니다.제품문의 T)1577-4395
답변 본 정보는 네티즌에 의해 작성된 정보로, 내용 중 중요하다고 생각되는 부분은 추가적인 사실 확인을 반드시 하시길 바랍니다.
개구리별숲  |  2016.02.22   

화면 우상단
Send: > Choose Destination (File) > Format (FASTA)

순서대로 클릭하시면 쉽게 다운로드 받으실 수 있습니다.
FASTA 포맷 파일은

>sequence name 1
nucleotide sequence 1
>sequence name 2
nucleotide sequence 2
>sequence name 3
nucleotide sequence 3
.
.
.

로 구성되어 있습니다.
메모장으로 열어서 작업할 수 있습니다.

개구리별숲  |  2016.02.22   
예를 들면,

파일명: 16S_primers.fasta
내용(메모장):
>785F
GGATTAGATACCCTGGTA
>805R
GACTACCAGGGTATCTAATC
>533F
GTGCCAGCMGCCGCGGTAA
>518R
GTATTACCGCGGCTGCTGG
>27F
AGAGTTTGATCMTGGCTCAG
>1492R
CGGTTACCTTGTTACGACTT
올챙이신입사원  |  2016.02.23   

별숲님 답변감사드립니다.

답변하기
할인행사 광고 검색광고
케이비티 케이비티
Stirrer, Dry Bath, Shaking Incubator, Thermo Shaker 등 다양한 제품.. (6.31까지)
프리미엄 등록안내
외부제휴사 광고 AD
e브릭몰
1/6  좌우
130,400123,900
86,90082,600
87,40083,100
153,100145,500
121,800115,800
276,800263,000
67,10063,800
126,900120,600
92,30087,700
111,300105,800
1,676,8001,593,000
80,40076,400
51,40048,900
47,20044,900
62,00058,900
50,40047,900
195,700186,000
272,100258,500
154,700147,000
55,70053,000
111,900106,400
139,400132,500
339,000322,100
60,70057,700
최근등록   더보기 >
cell lifter? liffer? 사용법   04.05
Ni-NTA 칼럼 비드의 맥시멈 사용횟수는 어떻게 될까요?   04.05
Western blot과 Real-time PCR에 결과 값이 다른것에 질문이 있습니다.   04.04
기기 차이   04.04
hemolysis activity의 positive strain이 궁금합니다.   04.04
미세조류(클로렐라) 배양 시 탄소원 문의   04.04
elisa   04.04
미생물 배양, 단백질 정제 화학지식?   04.04
hiv가 하루에 감염/제거하는 CD4+세포수, CD4+세포가 제거하는 hiv수   04.03
NI-NTA resin 공기 노출시 아예 사용못하나요?   04.03
이화여자대학교
ZEUS
위로가기
실험 홈  |  실험FAQ  |  실험 문의 및 제안
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의 member@ibric.org
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
머크