[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 회원가입   로그인
BRIC홈 실험
2019 Bio Top5 인터뷰
스폰서배너광고 안내  배너1 배너2
전체보기 안전점검 논문교환 LABox
 전체 > Molecular Biology-DNA > Gene Cloning
조회 1122  스크랩 인쇄하기 주소복사 트위터 공유 페이스북 공유 
질문 cloning 진행중 primer 문제
primer고민  |  2014.08.06 14:55
답변있는 질문은 수정/삭제 불가(☞문의)
다음과 같은 gene을 이용하여

1,574 bp linear mRNA

ATGGCCAACAAGGGTCCTTCCTATGGCATGAGCCGCGAAGT
GCAGTCCAAAATCGAGAAGAAGTATGACGAGGAGCTGGAGG
AGCGGCTGGTGGAGTGGATCATAGTGCAGTGTGGCCCTGAT
GTGGGCCGCCCAGACCGTGGGCGCTTGGGCTTCCAGGTCTG
GCTGAAGAATGGCGTGATTCTGAGCAAGCTGGTGAACAGCC
TGTACCCTGATGGCTCCAAGCCGGTGAAGGTGCCCGAGAAC
CCACCCTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCA
GTTCCTGAAGGCGGCTGAGGACTATGGGGTCATCAAGACTG
ACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATG
GCAGCAGTGCAGAGGACCCTGATGGCTTTGGGCAGCTTGGC
AGTGACCAAGAATGATGGGCACTACCGTGGAGATCCCAACT
GGTTTATGAAGAAAGCGCAGGAGCATAAGAGGGAATTCACA
GAGAGCCAGCTGCAGGAGGGAAAGCATGTCATTGGCCTTCA
GATGGGCAGCAACAGAGGGGCCTCCCAGGCCGGCATGACAG
GCTACGGACGACCTCGGCAGATCATCAGTTAG

cloning 진행중입니다.
restriction emzyme은 프로그램을 통해 BamHI과 XhoI을 선택하였고

primer는 각각
F      AT GGATCC ATGGCCAACA     Tm 53.7ºC

R    AGG CTCGAG CTAACTGATGATCT   Tm 55.2ºC

이렇게 제작하였습니다.

헌데 자꾸 dimer처럼 100bp 아래쪽에 짙은 밴드만 보일뿐
원하는 위치에 전혀 밴드가 보이지 않아요 ㅠㅠ

92도 2분
92도 1분      --------
AT   50초            32cycle
72도 50초    --------
72도 5분
4도

AT는 현재 50도, 52도, 53도, 54도 이렇게 진행하였습니다.

혼자 클로닝 공부하려니 모르는게 너무 많아서 문제입니다.
 
조언 부탁해요 ^^ 감사합니다.

#클로닝
 
#primer
답변하기
검색광고 검색광고
[(주)필코리아] NEB(New England Bio labs)한국총판 필코리아에서 주문하세요!
NEB (New England Bio labs) 한국총판 필코리아입니다. 저렴하고 빠른 배송으로 고객의 연구비와 시간을 절약해드립니다. 전국 어디서나 주문하세요. T:02-2105-7020, F:02-2105-7025, mail: info@philekorea.co.kr
[에펜도르프코리아] Eppendorf PCR장비,Thermal Cycler
새로운 Mastercycler X50은 식품 테스트 등 정기적인 PCR 실험의 표준화와 연구 PCR 실험을 위해 속도, 유연성 및 PCR 최적화가 결합된 솔루션입니다.제품문의:1577-4395
답변 본 정보는 네티즌에 의해 작성된 정보로, 내용 중 중요하다고 생각되는 부분은 추가적인 사실 확인을 반드시 하시길 바랍니다.
개구리미완의꿈  |  2014.08.06   
아랫쪽 band는 primer dimer 맞구요

제생각에는 primer에 포함되어있는 insert DNA sequence부분이 너무 적은것 같습니다.

올챙이마추피추  |  2014.08.06   

윗분과 마찬가지로 제의견도 primier 상의  insert 염기를 좀더 길게 해보는게 좋을것같네요 .

알초달  |  2014.08.06   
annealing이 제대로 되는 부분의 sequence를 늘리는 것이 정답입니다~~


새로 프라이머를 주문하시려니 돈도들고 지금까지 한 것이 아깝긴 할 것입니다만, 미련을 버리시고 바로 더 긴 primer를 합성하시는 것이 좋겠습니다.
올챙이초보닭  |  2014.08.07   
최소18 conserved residue가 필요합니다.

primer고민  |  2014.08.07    

모두 답변 감사합니다 ^^

답변하기
할인행사 광고 검색광고
에펜도르프코리아 에펜도르프코리아
Eppendorf New 25mL Conical Tubes : 혁신적인 디자인과 다양하고 편리한 사용 (4.1까지)
프리미엄 등록안내
외부제휴사 광고 AD
e브릭몰
βeta
1/6  좌우
28,00027,000
671,700638,000
136,000129,000
95,40091,000
264,400251,000
53,70051,000
39,40037,000
98,10093,000
191,600182,000
51,50049,000
211,500201,000
50,00048,000
76,80073,000
25,80025,000
22,70022,000
162,500154,000
86,90083,000
37,60036,000
178,700170,000
242,400230,000
72,20069,000
415,400395,000
81,30077,000
98,90094,000
최근등록   더보기 >
천연물 분획물 수율계산   01.29
Calcein,DAPI, EtheD staining 후 PCR sampling   01.29
바이오마커(cytokine) 및 독성 분석 의뢰하는 곳 아시나요?   01.29
희석 방법(계산법)   01.29
프락토올리고당 ym배지 실험시 효모에 대해서   01.29
buffer 만들기 (M 계산)   01.29
존경하는 선생님들께   01.29
ICC BSA농도관련   01.29
MTT assay초보입니다 흑흑   01.29
TNF alpha와 IFN gamma 의 활성을 알아보는 방법에 관한 질문입니다.   01.29
데일리파트너스
ZEUS
위로가기
실험 홈  |  실험FAQ  |  실험 문의 및 제안
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의 member@ibric.org
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS