[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 sale 회원가입   로그인
BRIC홈 실험
검색광고안내
산으로 가는 전공 이야기
스폰서배너광고 안내  배너1 배너2 배너3 배너4
과학으로 본 코로나19 (COVID-19)
전체보기 안전점검 논문교환 LABox
 전체 > Molecular Biology-DNA > Gene Cloning
조회 1358  스크랩 인쇄하기 주소복사 트위터 공유 페이스북 공유 
질문 cloning 진행중 primer 문제
primer고민  | 2014.08.06 14:55
답변있는 질문은 수정/삭제 불가(☞문의)
다음과 같은 gene을 이용하여

1,574 bp linear mRNA

ATGGCCAACAAGGGTCCTTCCTATGGCATGAGCCGCGAAGT
GCAGTCCAAAATCGAGAAGAAGTATGACGAGGAGCTGGAGG
AGCGGCTGGTGGAGTGGATCATAGTGCAGTGTGGCCCTGAT
GTGGGCCGCCCAGACCGTGGGCGCTTGGGCTTCCAGGTCTG
GCTGAAGAATGGCGTGATTCTGAGCAAGCTGGTGAACAGCC
TGTACCCTGATGGCTCCAAGCCGGTGAAGGTGCCCGAGAAC
CCACCCTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCA
GTTCCTGAAGGCGGCTGAGGACTATGGGGTCATCAAGACTG
ACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATG
GCAGCAGTGCAGAGGACCCTGATGGCTTTGGGCAGCTTGGC
AGTGACCAAGAATGATGGGCACTACCGTGGAGATCCCAACT
GGTTTATGAAGAAAGCGCAGGAGCATAAGAGGGAATTCACA
GAGAGCCAGCTGCAGGAGGGAAAGCATGTCATTGGCCTTCA
GATGGGCAGCAACAGAGGGGCCTCCCAGGCCGGCATGACAG
GCTACGGACGACCTCGGCAGATCATCAGTTAG

cloning 진행중입니다.
restriction emzyme은 프로그램을 통해 BamHI과 XhoI을 선택하였고

primer는 각각
F      AT GGATCC ATGGCCAACA     Tm 53.7ºC

R    AGG CTCGAG CTAACTGATGATCT   Tm 55.2ºC

이렇게 제작하였습니다.

헌데 자꾸 dimer처럼 100bp 아래쪽에 짙은 밴드만 보일뿐
원하는 위치에 전혀 밴드가 보이지 않아요 ㅠㅠ

92도 2분
92도 1분      --------
AT   50초            32cycle
72도 50초    --------
72도 5분
4도

AT는 현재 50도, 52도, 53도, 54도 이렇게 진행하였습니다.

혼자 클로닝 공부하려니 모르는게 너무 많아서 문제입니다.
 
조언 부탁해요 ^^ 감사합니다.

#클로닝
 
#primer
답변하기
답변 본 정보는 네티즌에 의해 작성된 정보로, 내용 중 중요하다고 생각되는 부분은 추가적인 사실 확인을 반드시 하시길 바랍니다.
개구리미완의꿈  |  2014.08.06   
아랫쪽 band는 primer dimer 맞구요

제생각에는 primer에 포함되어있는 insert DNA sequence부분이 너무 적은것 같습니다.

올챙이마추피추  |  2014.08.06   

윗분과 마찬가지로 제의견도 primier 상의  insert 염기를 좀더 길게 해보는게 좋을것같네요 .

알초달  |  2014.08.06   
annealing이 제대로 되는 부분의 sequence를 늘리는 것이 정답입니다~~


새로 프라이머를 주문하시려니 돈도들고 지금까지 한 것이 아깝긴 할 것입니다만, 미련을 버리시고 바로 더 긴 primer를 합성하시는 것이 좋겠습니다.
올챙이초보닭  |  2014.08.07   
최소18 conserved residue가 필요합니다.

primer고민  |  2014.08.07    

모두 답변 감사합니다 ^^

답변하기
할인행사 광고 검색광고
하나과학 하나과학
Socorex 2020 BIG SALE event - Socorex Acura manual micropipe.. (1.31까지)
케이비티 케이비티
Mixer, Dry Bath, Heating Block, Thermo Shaker, Shaking Incub.. (10.22까지)
다온비에스 다온비에스
내 소중한 세포를 위해 안심하고 맡길 수 있는 WOLF Cell Sorter를 경험하세요! (12.31까지)
필코리아테크놀로지 필코리아테크놀로지
무료 샘플로 명품 NEB의 DNA/RNA Purifucation 성능을 경험하세요. / NEBulider®.. (9.29까지)
에펜도르프코리아 에펜도르프코리아
[에펜도르프코리아] Eppendorf 2020 하반기 프로모션 행사 : 실험실 필수품 피펫,원심분리기,PCR.. (12.31까지)
인성크로마텍 인성크로마텍
Phenotype MicroArray™ - Live Cell 에너지 대사 & 감수성 프로파일링 (10.31까지)
브래디 브래디
[브래디] 초저온라벨 등 실험실용 라벨링 솔루션 (COVID19 안전사인 등) (10.30까지)
그린메이트바이오텍 그린메이트바이오텍
TECAN 한국대리점 20주년 기념 Microplate Reader & Washer 할인이 쏟아진다! (12.31까지)
외부제휴사 광고 AD
e브릭몰
5/6  좌우
136,000
50,00015,000
245,20073,600
79,50075,600
47,20044,900
22,7006,900
309,000
739,000702,100
230,000
136,000129,200
139,000132,100
388,500116,600
242,40072,800
201,30060,400
158,40047,600
924,000
80,40024,200
793,400238,100
246,60074,000
379,000
887,200266,200
238,70071,700
143,800136,700
555,000
최근등록   더보기 >
항균 항진균 실험 (균주 현탁액 제조) 문의   09.25
Autophagy LC3B, p62 antibody Novus vs Cell signali...   09.24
지방분해 관련 항체(HSL)   09.24
단백질 정량 온도   09.24
갑상선 기능 항진증 치료 시   09.24
동물실험에서 대조군으로 PBS사용   09.24
키트보관 온도   09.24
이 미생물은 무엇일까요??제발 알려주세요   09.24
Tail vein injection   09.24
피톤치드 추출 실험   09.24
Terumo bct
실험관련연재
박은총 연재중후배에게 주고 싶은 면역학 노트
박은총(Duke University)
신코 연재중분석장비 이야기
분석장비 탐험가 (필명) ((주)신코)
Mr.S 연재중의학계의 Spectaculum: 임상시험
Mr. S (필명) (연세대학교)
에스프리 연재중실험을 해봅시다
에스프리 (필명)
곽민준 연재중랩노트
곽민준 (POSTECH 생명과학과)
이제욱 연재중생명과학자 기초체력 다지기
이제욱 (오송첨단의료산업진흥재단, 신약개발지원센터)
ZEUS
위로가기
실험 홈  |  실험FAQ  |  실험 문의 및 제안
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의 member@ibric.org
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
에펜도르프코리아 광고