[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
에이비클로널
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
BioLab 장재봉 교수
전체보기 안전점검 LABox
 카테고리: 전체
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. 면역염색이나 wb 실험시 2차 antibody관련 질문
필요한 1차 항체를 몇가지 찾다가   source에 rabbit과 rabbit IgG 가 구분되어서 적혀 있던데,   둘 다 2차 antibody를 rabbit으로 사용하면 되는건가요?   아니면 rabbit IgG에 맞는 2차 antibody가 있는건가요? 구분해서 붙여야 하나요?
회원작성글 용구리  |  02.01
Q. 세포동결 할 때 vial 안으로 들어가는 액체 질소
cryo vial을 사용중인데, 동결 시 바이알을 꽉 잠그고 -80도에 보관 후, 액체질소(liquid nitrogen)로 옮깁니다. 동결 후 풀면 세포 상태가 너무 안좋고 붙어있는 셀 양도 별로 없어 질문남깁니다 ㅠㅠ  1. 동결을 풀기위해 액체질소에서 꺼내면 vial안에 액체질소가 들어서 부글부글 끓는 것이 보입니다. 정상인가요..? 그리고 꽉 닫았던 뚜껑들도 뚜껑이 얼어 다 헐렁헐렁해져서 살짝만 힘줘도 열려버립니다...  2. 안에 액체질소가 들어가더라도 세포는 사용이 가능한가요?? 액체질소에 닿으면 세포에 타격이 가나요.. 3. 안에 들어간 액체질소를 빼주고 사용해도 된다면, 뚜껑을 열지않고 엎드리기만해도 액체질소가 빠져나오던데 이렇게 빼주면되나요 아니면 꺼내자마자 뚜껑을 살짝 열어 빼주면 되나요..?   * 저는 액체질소에서 빼내서 실험실로 가져가 바로 37도에 녹입니다. 닫힌상태에서도 증발이 된다면 녹이는 과정이나 들고옮기는 과정에서 다 날라가지않나요..?? 근데도 세포가 이상해서 ㅠㅠㅠ 
회원작성글 마징가도리  |  02.01
Q. TLC 질문 드립니다.
TLC관련 질문 드립니다. 왼쪽은 쿠마린 이라는 스탠다드 물질의 농도를 잡기 위해 실험한것으로 0.2,0.02,0.002g/ml입니다. 오른쪽은 양쪽이 스탠다드이고 중간에 세개의 spot은 곰팡이의 배양액입니다. 배양액이다 보니 탄소원이 들어있어서 파란색으로 나온것인지 아니면 아예 다른물질들이 들어있어서 파란색으로 나온것인지는 잘 모르겠으나 실험 결과 상 쿠마린 스탠다드와 동일한 위치에 밴드가 없는 것으로 보아 이 배양 액에 쿠마린이 없는 것으로 판단해야 될지 모르겠습니다. 추가적으로 배양액 sample들이 전개 되지 않은것이 이동상이 잘못되어서 인지 아니면 sample에서 많은 물질들이 추출되어서 인지 잘 모르겠습니다.
회원작성글 김소현이다  |  02.01
Q. normal cell line
안녕하세요. 석사 1년차에 접어들게된 초보 연구자 입니다. 최근에 암연구를 하게 되어 현재 breast, liver, pancreas, stomach cancer에 대해 연구를 하게 되었는데 normal cell line을 한국세포주은행에서 얻을수가 없더라구요.  제가 찾은 cell line은  breast: MCF-10, MCF-10A, MCF-12A, MCF-12F, HBL-100, 184A1, 184A5 liver: Fa2N-4 pancreas: H6c7 stomach: HGaEpC 이렇게 있는데 다른 normal cell line이어도 괜찮습니다. cell line 분양 해주실 수 있다면 연락 부탁드립니다. jmk95@naver.com 010-6899-1058
회원작성글 newbee  |  02.01
Q. HPLC peak 재현성(나오다 안나오다 함)
안녕하세요. C18 컬럼을 이용해서 같은 용매로 같은 바이알을 여러번 찍는데 peak가 나오다 안나오다 합니다ㅠ 이런 경우 원인이 뭘까요?ㅠㅠ 이동상은 98% MeOH로 iso이며 시료 전처리는 그냥 에탄올에 희석입니다.
회원작성글 지이  |  02.01
Q. vero/hslam cell counting 질문
vero/h 가지고 실험해보는 학생입니다.  6well 96well 에 각각 깔아 plaque assay를 할려고 하는데  6well에는 4x10^5  96well에는 1.5x10^4 으로 well당 깔라고 알려주셨는데 cell counting해보니 1ml당 3.5x10^6이 나왔습니다 DMEM을 섞어 농도를 맞춰주는데 각각 몇씩 추가해주어야 알맞은 농도가 나올까요?.. 계산하는 법도 알려주시면 감사합니다..   초보적인 질문이라 죄송해요 ㅠㅠ
회원작성글 클로나  |  02.01
Q. 계산법 맞을까요??
이번에 buffer를 만들기 위해서 여러가지를 구매중인데 처음으로 저 혼자서 구매하는거다보니 확실하지 않은것들이 있어서 질문드립니다. 우선 buffer를 만들때 4가지정도가 들어가는데 그중 한가지가 50mM의 용량으로 넣으라는 protocol이 있습니다. 그 reagent의 MW는 65.01이고요 근데 보통 저희는 stock을 만들때 working 농도의 1000X를 만드는데 그럼 저는 50M를 만들어야되는거 아닌가요 1M = 65.01 g/L인데 그럼 만약 500ml기준으로 stock을 만든다면  1M = 65.01 g/L = 65.01 mg/ml  50M = 1.30 mg/ml   -> 500ml 기준 650mg을 넣으면 50M이 되는게 맞는건가요...?    
회원작성글 브르르르릭  |  01.31
Q. 동물세포 관찰이나 사진촬영을 위한 염색 방법
안녕하세요. 인간유래 피부세포로 세포 증식활성 실험중입니다. 보통 Cell counting kit-8로 세포 증식능 데이터를 내는데 대조군과 비교가능한 사진도 같이 찍습니다. 사용하는 현미경은 일반 세포 관찰용 현미경인데 배율에 따라 사진도 잘찍힙니다. 문제는 세포가 좀 더 또렷하게 보이게끔 세포를 염색시켜서 사진을 찍으려고 하는데 이 때 사용할수있는 세포 염색약이 있을까요? 찾아보니 trypan blue로 동물세포 염색을 한다는데 이 염색약은 죽은세포를 염색시킨다고 하더라구요 형광은 사용이 안되어서 형광을 제외한 세포 염색법이 있으면 알려주시면 감사하겠습니다 아래처럼 세포 사진을 찍을수있는 방법은 무엇인지 알수있을까요?
회원작성글 yeaharrr  |  01.31
Q. carrier 단백질 사용 농도가 궁금합니다.
안녕하세요. 학부 졸업후 연구원으로 재직하고 있는 사람입니다.   단백질 보관기간을 늘리고자 정보를 검색했을떄 carrier 단백질을 넣으면 보존기간이 늘어난다고해서요.  단백질 안정제와 carrier 단백질과 같은 의미로 이해해도 될까요? 또한 제가 찾은 carrier 단백질 종류는 BSA, sucrose, glycine, glycerol 정도인데 이 시약들은 보통 어느농도로 사용되나요?    답변 부탁드립니다.  감사합니다.
회원작성글 헤언김  |  01.31
Q. NAA 분말 녹이는 방법
안녕하세요! 배지에 NAA를 첨가하고 싶은데 분말을 용액으로 만들어서 사용하기도 하더라고요 그렇게 하면 더욱 첨가할 때 용이할 것 같아서 시도해봤는데 증류수에 NAA 분말을 넣고 교반기에 아무리 돌려도 녹지 않고 뜨더라고요..?ㅜㅜ 어떻게 녹일 수 있을까요?ㅜㅜ
회원작성글 유숩니  |  01.31
Q. VLC 농축이 안되는이유
VLC를 해서 분획물을 분리해서 V1에서 V31까지 얻었습니다. 근데 이 분리된 물질을 농축을 하려니까 나머지는 다 잘농축이 되었는데 V20부터 V22번까지가 농축이 되다가 어느정도가 한계인것같이 액체가 좀 남은상태로 계속 농축이 안되네요.. 5g을 분리했는데 분리농축된 물질들의 무게를 다더하면 농축안되는 애들때문에 5g이 훨씬 넘습니다..... 왜 농축이 안되는걸까요...
회원작성글 피븃  |  01.31
Q. 분자량으로 stock solution 만드는 법
분자량은 460인 powder를 DW에 녹여 100mM의 stock solution을 1mL 만들려고 한다면 얼마의 powder를 DW 1mL에 넣어야하나요?
회원작성글 SoliDeo  |  01.31
Q. column chromatography
column chromatography를 진행 중이고, 고정상은 실리카입니다. 샘플 물질에 금속이 붙어 있고 분자량이 크며 8개의 Cl이 달려 있어 잘 내려오지 않는 상황입니다. 이 때, 이동상으로 DCM(100%)이나, DCM에 Methanol을 소량 섞어 이용하였을 경우에는 매우 천천히 내려오기는 하지만 컬럼 전체에 끌리면서 내려옵니다. Ethyl acetate나 Methnol을 100%로 사용하는 경우에는 아예 내려오지 않습니다... 아래부터 질문입니다. 1. 위와 같은 경우에는 이동상의 극성이 문제가 아닌 것 같은데, 용해도 때문이라고 볼 수 있을까요? 2. 용해도가 원인일 경우, THF나 Chloroform 등을 이동상으로 사용해보는 것도 도움이 될까요? 3. 분리하려는 샘플 물질에 Cl이 8개가 달려있는데, 물질에 Cl이 달려있으면 컬럼에서 끌려내려올 수 있다고 알고 있습니다. 이럴 경우 끌림을 개선할 수 있는 방안이 있을까요? 궁금한 것을 바로 적다보니 글이 두서없는 점 양해부탁드립니다...
회원작성글 국물자작  |  01.31
Q. 약물의 dialysis bag 통과 관련 질문 / DDS / in vitro (급해요 ㅠㅠ )
dexamethasone palmitate를 활용하여 in vitro release test를 진행하고 있습니다. 분자량은 630.87이며, release media는 1% tween 80 PBS (100mL) 입니다. dialysis bag method를 활용해 37ºC에서 100rpm으로 진행하고 있습니다. donor에는 동일한 release media에 dex-pal을 37ºC에서 1mg/mL로 녹인 후 0.2um PVDF로 filteration한 solution을 1mL 넣어주고 있으며, 100% solution 농도는 약 0.221mg/mL입니다. release media에 대한 dexamethasone palmitate의 용해도는 100mL 당 30mg정도로 상당히 높은 편이며 sink condition을 충족합니다.  사이즈를 계산한 결과 6-8 kD dialysis bag을 사용하여도 충분히 통과되어야 하는데, 분석 결과 24시간이 지난 후에도 약물이 전혀 방출되지 않고, 100 kD Float-A-Lyzer G2 dialysis tube 에서도 똑같은 진행해보았는데, 일주일 간 방치해 보았을 때에도 약물 방출이 전혀 되고 있지 않아 질문드립니다. 또한 tween80과 약물의 상호작용으로 인해 미셀을 형성할 지도 모른다는 가설이 있어 PBS에 EtOH를 10% 섞어 외상으로 두고 동일한 방법으로 실험을 진행하여 보았으나 결과는 동일했습니다.. ㅜ dialysis bag release 전문가 선생님들 ..! 혹시 이럴 때 어떤 방식으로 문제를 해결해야 할 지 도와주세요..!  
회원작성글 유미유미윰윰  |  01.31
Q. Deep freezer 샘플 이동
안녕하세요 저희가 있는 연구실에서 Deep freezer를 3~4일간 못 쓰게 될 예정인데 이 때 동안 보관할 수 있는 업체나 장소가 있을 까요?
회원작성글 nssok789  |  01.31
Q. qPCR시 tamra pimer를 sybr green에 혼용해서 사용해도 되나요?
안녕하세요.  qPCR을 primer를 논문에서 찾아봤는데 tamra primer를 사용한 논문을 찾았습니다.  protien F,R primer서열 + FAM-5’ TTCCGGGATGCCGCTGCAAAG3’-TAMRA 알려주었는데 저희 랩은 sybr green을 사용해서 protein F,R서열만 가져와서 qPCR을 해도 괜찮을 거라고 생각이되는데 혹시 안되나요?? 서열 길이를 다 확인해본 결과 70-100bp내외였습니다.   추가적으로 sybr green으로 qPCR을 진행 할 경우 100-200bp내외로 primer을 구상한다고 하던데 250bp정도로 길어지면 문제가 발생 할까요?
회원작성글 규쟁  |  01.31
Q. cell morphology 관련 질문 드립니다. 첨부파일
cell line은 HaCaT 이고, 1XPBS로 washing 후, media(DMEM) change 직후 사진입니다. RNA isolation 을 진행하기 위해 12-well plate에 seeding 해 둔 상황인데, media change 하기 직전까지는 괜찮았던 cell이 저렇게 되니 당황스럽네요ㅠㅠ 왼쪽 부분이 제가 평소에 아는 HaCaT morphology이고, 오른쪽 부분은 마치 cell이 터진 것처럼 물방울이 cell 주위에 형성된 저는 처음 보는 비정상적인 모습입니다. 혹시 이런 비슷한 경우를 경험하신 분이 있나요? 있으시다면 원인이 무엇인가요?ㅠㅠ 나름 HaCaT cell culture를 컨탐 없이 해왔어서, 원인을 정확히 모르겠습니다ㅠ
회원작성글 shinhwa  |  01.31
Q. 세포주 가능한 계대배양 횟수 확인방법
한국세포주은행에서 세포주를 검색하면 passage number까지 알 수 있다고 들었는데 culture method와 culture morphology까지만 보입니다.. 미천한 학부생에게 가르침을 주십시오
회원작성글 앞구르기  |  01.31
Q. SDS 전기 영동 시 기계의 문제로 밴드가 흐리게 나올 수도 있나요?
안녕하세요, 이제 갓 랩실에 들어온 예비 석사생입니다. 이번에 계속해서 SDS 전기 영동을 하고 있는데 밴드가 계속 흐리게 나와서 질문드립니다. 분명 같은 시료를 다른 농도로, 처음에는 750ug/ml 이번에는 1mg/ml로 희석하여 실시 하였는데 처음에는 밴드가 선명하게 나왔지만 이번에는 잘 나오지 않았습니다. 결국에는 마지막에 와서 기계가 망가졌는데 혹시 기계 문제로 밴드가 흐리게 나오거나 아예 안 나올 수가 있나요?
회원작성글 jeansflow  |  01.31
Q. 초음파분쇄기 없으면 다른수단 있을까요
물질을 용해시키려고 데이타시트를 보니 용매를 넣고 ultrasonic 초음파 분쇄하라고 되있는데요 현 위치에 기자재가 없습니다. 볼택싱을 1분이상 했는데도 안되네요ㅠㅠ 청소용? 소니케이터(워터배스모양)는 있는데요 거기에 튜브를 담그어 볼까요? 아님 다른 방법이 있을까요?
회원작성글 pretty  |  01.31
이전  1 02 03 04 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
머크 광고