[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
필코리아테크놀로지
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
[우당탕탕 석사 적응기] 석사 1학기 - 새로운 환경, 그리고 후회
전체보기 안전점검 LABox
 카테고리: 전체 > Molecular Biology-DNA > PCR/RT-PCR/Q-PCR
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. SYBR로 realtime 수행 시 필요한 DNA template 최소 농도가 몇인가요?
SYBR로 realtime 수행 시 필요한 DNA template 최소 농도가 몇인가요? 제가 가지고 있는 샘플 중 가장 적은 농도인게 5ng/ul 거든요.. 그래서 모든 샘플을 최소 농도 샘플에 맞춰서 5ng/ul로 희석한 후 SYBR으로 realtime을 돌리려고 하는데 농도가 너무 낮나요?? 또 하나 궁금한거는 농도가 낮다고 해서 검출 될게 안되거나 그렇진 않겠죠??
회원작성글 soor  |  04.30
Q. PCR PREP 효율 높이기
RT-PCR 실험에서 prep 가 자꾸 ct값이 낮게 나오는데 (이론상 23ct 실제는 27) 어떻게 해야 ct값이 높아질수 있을까요?(균주는 BADV 정량 실험입니다) 저희는 일단 spin column 방식으로 dna 추출합니다. 균주는 보통 200㎕에 Proteinase K 20㎕에 BA buffer 200㎕ (아마 Lysis buffer일종) 혼합해서 Incubator 60℃ 10min 하고 99% ethanol 400㎕ 넣고 Pipetting 하는데 여기서 저는 Pipetting을 겁나 하면 DNA가 좀더 뭉치지 않을까? 생각해서 많이 해보기도 하고 조금하기도 하는데 실험실 제약이라고 해야할지... 어러 시도를 하기에 지원의 한계가 있어서 자료 수집을 많이 못했어요 저는 5번이 적절?하다 생각은 들었는데 아직 확실한 증거가 부족하네요. Binding column tube넣었을 때는 WA1 500㎕랑 W2 500㎕ 8000rpm, 1min 씩 하는데 마지막에 column에 buffer 남아있으면 안되잖아요? 그래서 공회전 13000rpm, 1min 하는데 저는 드는 생각이 1분 충분한가? 생각도 들어요. 근데 3분하다 dna다 잃으면......그리고 EA buffer을 200㎕ 넣는데 원래 DNA 잘 추출 안나오거나 옅으면 EA buffer 줄이잖아요 그래서 100㎕만 쓰려고 하는데 될까요? 정량분석이라 DNA농도를 억지로 높이는것 같아서 이 방식을 해도 되는지... 의문이네요. 그리고 요번에 새로 생각한 방식인데 추출한 prep를 spin down하면 상층액과 하층액의 DNA농도가 몰린다고 했는데 그래서 저는 생각한게 일부러 spin down해서 하층액 100㎕를 실험에 써서 희석해서 정량 분석하면 좋지 않을까 생각도 했지만 그러면 이게 순수 정량이 맞는지 걱정됩니다. 아직 학부생이라 실험을 막 할수 있는 환경이 아니라 조언 얻고 싶네요 ㅠ
회원작성글 고로쇠물  |  04.29
Q. primer 제작
안녕하세요.   사람 PBMC에서 RNA를 prep한 뒤, cloning하기위해서 RT-PCR 하는 중입니다. 논문에 게재된 primer를 그대로 주문했는데,  pcr 결과가 제대로 나오지 않아요..  NUDT15 cDNA_Forward  GTGAGCGCGTCACTTCCTGC NUDT15 cDNA_ Reverse  ATCAAATCTTCTCGGCCACCTAGAG 그래서 제가 만들어서 주문하려고  NUDT15 variant를 확인했는데,  57 nt~ 437 nt 사이에 중간중간 있어서 PCR product 에 57-437 사이가 들어가게  primer를 짜려고 하니까 웹 primer 프로그램으로는 안짜집니다..ㅠㅠ 여러 프로그램 들 중에 젤 앞쪽이 66? 69? nt 부터에요..  어떻게 해야 primer 제작 할 수있을까요?  그냥 1nt부터 상보적으로 primer 20mer정도로 주문하면  PCR될까요?   
회원작성글 MELLOW  |  04.29
Q. pcr을 이용한 dna mutation 감지 실험인데 도움부탁드립니다. 첨부파일
해당 실험은 입안의 구강 천장을 긁어서 세포를 모으고 taq polymerase를 이용해서 진행한 pcr 실험입니다.   wild타입과 mutant 타입 두가지의 샘플을 만들었는데 각각의 샘플에는 동일한 forward primer를 사용했고 reverse primer만 서로 다른걸 사용했습니다.   실험 원리는 대충 reverse primer가 타겟 dna와의 염기서열이 match 되면 증폭이 일어나서 전기영동상에서 밴드가 더 진하게 보이고 mismatch되면 증폭이 일어나지 않아서 전기영동상에서 더 연하게 보인다까지는 이해했습니다.   하지만 왜 첨부파일에 specimen1에서는 mutant 샘플이 더 진하게, specimen2에선 wild 샘플이 더 진하게 보이는지 이해가 가지 않습니다.    답변 감사드리겠습니다
회원작성글 asdjkf  |  04.29
Q. realtime pcr 프라이머 질문
primer 3 프로그램을 이용해서 real time pcr 용 프라이머를 제작했는데요 밴드가 깔끔하게 안뜨고 계속 다이머가 뜨거나 밴드가 안떠서 재주문한 프라이머가 벌써 6번째에요 ㅜㅜ 온도 조절도 계속 해보고 하는데 안되네요.. product size가 150-250정도 되게 제작을 하다가 사이즈를 줄이는게 더 좋다고 들어서 100-150으로 줄였는데도 안되네요... 이런 경우에는 어떻게 해야할까요... product size를 100-150보다 더 줄여도 되는걸까요??? 꿀팁 부탁드립니다..ㅠ
회원작성글 quqqidlane  |  04.29
Q. RNA isolation 후 cDNA 합성과정
학부연구생 3일차 병아립니다.. 맨 처음 배우는 실험이 RNA prep하고 cDNA 합성까지 하는 실험인거 같은데 도저히 cDNA 합성하기전에 total RNA volume 맞추는게 너무 어렵습니다. 저희 랩실에서는 20ul을 총량으로 20xRTase 랑 5x buffer 랑 뽑아놓은 RNA를 이용해서 바로 revers transcription-PCR 하는 과정으로 실험하는것 같습니다. RNA 농도 측정하면 대체 어느 기준으로 20ul을 맞추는지 모르겠습니다. RNA 농도가 너무 낮으면 그냥 15 다 넣는다고 표현을 하고 농도가 높으면 DW사용해서 총 20 volume 맞춘다고 하는데 어떻게 구글링해야 이런 과정을 알 수 있을까요..???? 프로토콜을 찾아야하나요..??? 너무 허접한 질문이고 기초적인 질문 드려서 죄송합니다 ㅠㅠㅠ 고수님들 도와주세요 ㅠㅠ
회원작성글 자도  |  04.28
Q. cDNA PCR primer제작 방법이 궁금합니다ㅠㅠㅠ
안녕하세요 PCR 초보 석사생입니다..ㅠㅠ cDNA PCR primer제작을 해야하는데, 무조건 atg부터 primer를 제작해야하는지 궁금합니다. PCR sequence가 AT rich라서 tm 값이 너무 낮게 나와서 primer길이가 너무 길어지게 됩니다ㅠㅜ 바깥쪽 sequence 부터 잡아서 primer 제작하면 안될까요??   꼭 답변 부탁드립니다ㅠㅠ
회원작성글 만도리  |  04.26
Q. PCR 아가로스 겔이 메트릭스를 형성하는 원리가 궁금해요..
되게 어이없는 질문일 수 있지만... 옛날부터 궁금해서 몇번이고 찾아봤으나 딱히 궁금증이 해결되지 않아 질문을 올립니다 ㅠㅠ 제가 배웠을 때는 아가로스 겔을 만들면 아래로 갈수록 촘촘해져서 작은 DNA일 수록 아래쪽에 걸린다고 들었는데.. 이게 맞나요?? 왜냐면 아가로스 겔을 굳힐 때 세워서 굳히지 않고 평평하게 눕혀 굳히는데 어떻게 아래로 갈수록 겔이 촘촘해지고 DNA 사이즈별로 겔에 걸리는 건지 이해가 안돼요.. 혼자 아가로스 겔 전기영동에 찾아본 결과  겔을 굳히면서는 그냥 메트릭스만 형성되고 (아래로 갈수록 촘촘하다.. 이거는 아닌 것 같고) 전하에 의해 -를 크게 띄는 DNA가 위쪽에 걸리고 상대적으로 -를 적게 띄는 DNA가 아래쪽에 걸리는 것이 맞을까요??
회원작성글 맛도리  |  04.24
Q. real-time pcr 질문입니다!
안녕하세요  rna 발현량 확인하기 위한 real-time pcr을 진행하려고 하는데요, 레퍼런스 gene을 전기영동 내려보면 다음 사진과 같이 다이머가 형성이 됩니다. 이럴경우 정량화가 절대 불가능할까요?  레퍼런스 gene을 4개 테스트해봤는데 그나마 이 gene이 밴드도 진하게 하나 잘뜹니다..... 또, 저희 선배가 말하길 사진보면 진한 밴드 바로 밑에 연한 밴드가 하나 더 뜨는데 이럴 경우 타겟 밴드와 연하게 뜨는 밴드의 사이즈 차이가 너무 안나서 증폭곡선이 연달아 뜨기 때문에 이 레퍼런스 gene으로 real time pcr은 절대 불가능 하다고 하는데, 선배 말처럼 밴드 사이즈에도 영향이 가나요?? 도움 부탁드립니다...ㅠ
회원작성글 maemi  |  04.22
Q. RedSafe 관련 질문입니다...
시골학교 교사입니다   하필 지금 학교에 하나뿐인 UV transilluminator가 고장났이네요..   아무리 뒤져봐도 470nm UV밖에 없는데   Redsafe 이용해서 전기영동 결과 DNA 밴드 관찰할때    470nm 광원을 사용해도 관찰이 용이할까요? 당장은 시험해보기가 어려운 상황이라    혹시라도 유경험자 있으신지 해서 질문올려봅니다~
회원작성글 김생물은힘들어  |  04.22
Q. PCR 고수 있으신가요. SKOV-3 PCR Band한번만 봐주세요 첨부파일
안녕하세요 몇달째 SKOV-3 PCR로 애를 먹고 있는 대학원생입니다.  Annealing temperature도 범위가 10도 가까이 조절했는데도 불구하고 잘 잡히지 않아 문의드립니다.  다른 Cell로 진행했을 때 54~55 사이의 온도에서 dimer하나 없이 깔끔히 나오는데  꼭 SKOV-3로만 진행하면 이렇게 나타납니다.  경험 많으신 분들의 조언이 필요합니다.  셀마다 서열이 다르니까 같은 Primer여도 annealing temperature가 다른건가요?  그렇다하더라도 온도 차이가 크게 나지 않을 것 같은데 유독 SKOV만 나오지 않아서 머리가 아프네요..   Primer: GAPDH  5' : 5' GAAGGTGAAGGTCGGAGTC 3' TM: 56.2 3' : 5' GAAGATGGTGATGGGATTTC 3' TM: 52.8 PCR 조건은 28Cycle, 52~59.9도 입니다.   RNA문제인가도 싶어서 Purify 280/260, 260/230, 1.8~2.2 가 정상범주가 아니면 사용하지 않고 있습니다. 혹시 이렇게 나오는 경우 무엇의 문제인지 알려주시면 감사하겠습니다. 
회원작성글 사고치는뚝딱이  |  04.21
Q. dna , agarose gel
target gene 을 PCR 한 후에 확인을 위해서 agarose gel 로 전기영동을 하였습니다.   TAE buffer 와 EtBr 사용했습니다만, running시에 온도가 많이 높아지고 속도도 느립니다. 다 끝난 후에는 gel이 많이 녹아서 확인을 할 수가 없는데 원인이 혹시 뭐라고 생각 되시나요
회원작성글 단백질결정  |  04.20
Q. primer design 하는 법 알려주세요 첨부파일
첨부된 사진 혹시 풀어주실 수 있나요?  
회원작성글 미생미생물  |  04.19
Q. TaqMan RT-PCR 해보신 분 있나요?
저는 기존에 SYBR Green 방식만 하다가 이번에 TaqMan 방식을 새로 해보려고 합니다. 그래서 primer와 probe는 기존 논문을 바탕으로 찾고 있습니다. 그런데 여기에 사용할 master mix가 문제인데.... 혹시 해보신 분 있으시면 괜찮은 제품 추천가능하실까요?   우선 제가 찾아본거는 Applied biosystems의 TaqMan PCR Fast master mix인데 보니까 TaqMan® Gene Expression Assay Mix(20X) 란 부분이 있더라구요 그래서 이 부분이 따로 별도로 구매해야하는건지, 아니면 정해진 농도만큼 primer와 probe를 섞으라는건지 궁금합니다..
회원작성글 차몬드  |  04.18
Q. Pcr후 엔자임컷 첨부파일
1.Pcr 0.8k 잡밴드많은데 맞나요? 2.밴드 잘라 일루션. 엔자임2컷후 젤런하니 0.8k보다 커진건가요? 3.pcr밴드보다 엔자임 컷후 dna양이너무 줄었어요.라이게이션 할 양이 너무 줄어든거죠?
회원작성글 blue^^  |  04.14
Q. bacteria qPCR 정량
안녕하세요.    bacteria qPCR 실험을 처음 맡게된 대학원생입니다....   처음 다루어보는 장비인데 도움받을 사람이 없어서 막막한 상황입니다.    저희 연구실에서 qPCR 장비를 이용하여 세균(bacteria)를 정량하려고 합니다.    qPCR을 이용하여 정량을 처음하는데 standard curve를 어떻게 만들어야할지 모르겠어서 질문드립니다. (농도(cp값, ng 등) 를 알고 있는 값이 필요할것 같은데... 다른 분들은 어떻게 하시는지... 도와주세요...)   bacteria를 정량하기위해 표준물질(reference material)을 구입해서 사용하는건지 막막합니다... (제가 못찾는건지... )   도움의 손길을 내밀어주시면 너무 너무 감사드립니다. 
회원작성글 rhksdn  |  04.14
이전  01 02 03 04 05 06 07 08 9 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
써모피셔사이언티픽 광고