[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
필코리아테크놀로지
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
[우당탕탕 석사 적응기] 석사 1학기 - 새로운 환경, 그리고 후회
전체보기 안전점검 LABox
 카테고리: 전체 > Molecular Biology-DNA > Gene Cloning
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. insert DNA를 vector에 클로닝하는 방법 질문드립니다
pGEM vector에 넣은 insert DNA를 pCL55 vector로 클로닝해야하는데 어떤과정으로 넣어야하는지 고수님들의 도움 부탁드립니다!ㅜ 1. pCL55를 enzyme cut을 한 후 2. pGEM vector안에 있는 DNA를 어떻게 enzyme cut된 pCL55 vector에 넣는것인지 모르겠습니다
회원작성글 PORI  |  04.02
Q. 플라스미드 supercoil이되는이유
plasmid가 supercoil이 되는이유는 topoisomease때문이라고 알고있는데요 여기서 negative positive (꼬아져있는형태) 로 grypseII  이렇게 알고있는데 인터넷으로봐도 이해가안가서 혹시 쉽게 설명해주시면 감사하겠습니다 ㅠㅠ
회원작성글 choheec  |  03.31
Q. SDM (deletion) 조건 이거 맞을까요?
안녕하세요.  저는 SDM을 처음 하고 있는 석사 2기 입니다. 우선, 각각 21bp, 42bp deletion 하는 SDM 하려고 합니다. 프라이머도 deletion 되는 부분 제외하고 앞 뒤로 15bp로 짰고요, forword, reverse 모두 상보적으로 design했습니다 template는 pBSK에 제가 원하는 dna를 삽입한 것으로 총 3.5kb입니다. nPfu-forte 로 95도 30초(hot start)랑 95도 30초-60도 1분-72도 4분으로 20 cycle을 돌렸습니다. 그러고 젤 로딩을 하면 밴드가 3.5kb 쪽에 형성하길 기대하는데, 제일 밑에 희미한 밴드만 있고 윗부분은  깨끗합니다... 혹시 어떤 조건으로 바꿔야하나요? 프라이머는 10pm을 사용했습니다....
회원작성글 bioer  |  03.31
Q. 클로닝 순서좀 확인좀 부탁드립니다
transformation후에 seedculture하여 플라스미드프렙후 유니버셜프라이머와함께 시퀀싱을 보냈습니다 이후에는 단백질발현을 시키는단계인가요,,? 그다음에 무엇을 해야할지모르겠습니다 답변 부탁드리겠습니다 ㅠㅠㅠ
회원작성글 choheec  |  03.31
Q. 유산균에 host로 클로닝하는 방법 조언구합니다..!!
PCR한 insert DNA를 pGEM 키트에 ligation하고, E. coli DH5a com cell에 transformation한 상태입니다 Lactobacillus MG1363을 host로 사용하여 유산균에 electroporation 하라고하셨는데 host의 의미를 정확히 모르겠습니다 1. Lactobacillus MG1363의 플라스미드를 뽑아서 vector에 넣어서 유산균com cell에 electroporation하는것인지 2. Lactobacillus MG1363 com cell을 만들어서 electroporation하고 다시 플라스미드를 뽑은후 유산균 com cell에 2차로 electroporation하는것인지 조언부탁드립니다 예정인데
회원작성글 PORI  |  03.30
Q. 플라스미드 클로닝 순서
plasmid prep후 pcr/doblucut/insert삽입/ligation/transformation후 plasmid prep후 시퀀싱까지 보낸다음에 그다음순서는 혹시 BL21에다가 plasmid prep 을 넣어 그다음에 iptg넣고 단백질발현시키는 단계가맞나요?
회원작성글 choheec  |  03.30
Q. plasmid prep후 전기영동
콜로니 딴 재조합된plasmid prep후 전기영동을하였습니다 insert가2kb인데 band가 왜저렇게나오죠..? 총합치면7kb정도되는데 저렇게 끌려서 나오는지 부탁드리겠습니다 ㅠㅠㅠㅠㅠㅠ아무리 찾아도 정보가나오지 않습니다..정상적으로나왔다면 band에 어떻게나오죠?
회원작성글 choheec  |  03.30
Q. plasmid prep후 시퀀싱보낼때 프라이머?
transformation이된 콜로니를 따서 miniprep을진행하였습니다 이제시퀀싱을 보낼예정인데 여기서 사퀀싱에보낼 프라이머는 어떤걸 보내야하며 왜프라이머가 필요한거죠 .....?
회원작성글 choheec  |  03.30
Q. GENE 구매
안녕하세요! 초보 학부연구생입니다. CLONING을 진행하려고 하는데 E.COIL DH5a(K12)의 clpB를 가지고 진행하려고합니다.그러기 위해서 GENE을 구매하려고 하는데 ORIGENE은 너무 비싸가지고 부담이 됩니다.. 혹시 더 저렴한곳이나 아니면 유전자를 다른곳에서얻을수있나요??
회원작성글 체리망규  |  03.30
Q. Dh5a inoculation 후 잘 안자라는 문제
안녕하세요 현제 shRNA를 이용한 cloning을 진행하고 있는 학생입니다. 본론을 말씀드리자면 박테리아가 잘 안자랍니다... 현제 시퀀싱까지 보내서 잘 클로닝된것을 확인하고  transgofmation해서 colony를 2ml의 LB에 amp 75ng/ml이 되도록 넣어 overnight 후 확인하였을땐 뿌옇게 자랐길래 100ml의 LB (amp 75ng/ml)으로 1ml 옮겨주고  남은 1ml은 stock으로 얼렸습니다.   근데 다음날 보니 100ml은 하나도 자라지 않았고 stock도 풀었는데 자라지 않았습니다.   이런적이 한 두번이 아니고 계속 반복되서  고민하다가 글 남겨봅니다...   어떤이유에서 이런 현상이 반복되는지 비슷한 경험있는 선생님들의 답변 부탁드려요...ㅎ
회원작성글 쟤스민  |  03.27
Q. cloning pcr
안녕하세요 cloning을 준비하는 초보 학부연구생입니다. 제가 궁금한 gene은 E.coil의 DH5a chaperone protein (clpB) gene입니다. 전체 염기서열이 580bp여서 프라이머는 밑에와 같이 짜보았습니다. F primer =  5' AGA TCT ATG CGG TTG ATG CGG TAT 3' (제한효소 Bgl2) R primer=  5' TCT AGA TAG TTA ATG AAT TCC GGA CGG 3' (제한효소 Xba1) GC값, TM값, SEIF annealing 값 모두 다 괜찮게 나왔고 run pcr을 돌렸을 때 제한효소가 중간에서 끊어내는 것도 없었습니다. 그럼 이렇게 진행해도 될까요? 아니면 전체 DH5a나 e.coil 서열까지 확인해서 전체 서열도 확인해 봐야하나요? 전체 서열이 프래임이 3으로 나눠져야한다는 말이 있는데 그건 혹시 어떤 말인지 알고 계시는 분 있으실까요?  
회원작성글 체리망규  |  03.25
Q. colony pcr할때 온도95℃10분씩 하는이유?
기본pcr 할때는 95℃5분 이였는데 colony pcr할경우에5분더늘어나서 총 10℃분으로 하는건가요? 위의 질문에관하여  조사해봤지만 제가알고싶은 온도에관해서 찾아도 정보가나오지않아 이렇게 선배님들께 여쭤봅니다 
회원작성글 choheec  |  03.25
Q. colony pcr할때 negative,positive
colony pcr을 진행하였고 positive로 insert와 negative plasmid를 넣고 실험하는데요, 정확하게 밴드에서 대조군에서 positive negative무엇을 의미하는지 알수있을까요 나오게된다면 실험에 성공적인band는 어떤양상을 보이는지 부탁드리겠습니다..! 
회원작성글 choheec  |  03.24
Q. Cloning 과정 중 sequencing과 bacterial stock의 순서
  합성된 DNA로 cloning을 진행 중에 문득 궁금증이 생겨 질문드립니다.   제 실험 순서는 1. 합성된 vector 수령 2. com.cell에 TF 및 plate에 도말 후 single colony 확인 3. single colony 5~6개 picking 하여 액체 배양 4. 액체 배양에서 일부는 bacterial stock (하나의 colony당 여러개)으로 만들어 보관 후 나머지는 mini-prep으로 plasmid를 뽑아 sequencing 확인 5. sequencing 결과와 대조하여 sequece가 일치하는 bacterial stock 하나만 남긴후 나머지는 폐기   이렇게 진행을 해왔는데 동시에 여러 샘플을 진행하다보니 bacterial stock을 만드는데 시간이 오래 걸릴 뿐더러 나머지는 폐기하는 과정이 불필요한것처럼 느껴집니다.   가끔 bacterial stock 만드는 과정을 건너띄고 seqencing 까지 마친 plasmid를 다시 com.cell에 TF 하여 액체배양 후 bacterial stock을 만들거나   액체 배양을 위해 single colony를 picking 하면서 새로 다른 plate에 그어놨다가 sequencing이 확인 되면 그 plate를 bacterial stock 만드는데 이용했습니다.   무언가 좀 더 효율적이고 간결한 방법이 있을 것 같은데 여쭤볼곳이 없어서 처음 질문글 남깁니다.   보시는 분들은 어떻게 실험하시나요?    
회원작성글 2240  |  03.24
Q. primer 짜기
안녕하세요! 아직 학부연구생으로 cloning을 준비하는 대학생입니다. 제 위에 사수도 없고 교수님도 질문을 받아주시는 분이 아니셔서 매번 고난을 겪고있습니다.. 제발 도와주세요 ㅜㅜㅜ cloning 주제로 DH5a의 clpB protein을 cloning하려고 준비중입니다. primer을 제작해야하는데 프로그램을 쓰지 않고 직접 제작하라고 말씀을 많이 하셔서 찾아보고 있습니다. 538bp에 염기서열은 아래와 같습니다. CGGTTGATGCGGTATCTAACGCTATTCGTCGTAGCCGTGCGGGGCTGGCGGATCCAAATCGCCCGATTGG TTCATTCCTGTTCCTCGGCCCAACTGGTGTGGGGAAAACAGAGCTTTGTAAGGCGCTGGCGAACTTTATG TTTGATAGCGACGAGGCGATGGTCCGTATCGATATGTCCGAGTTTATGGAGAAAACACTCGGTGTCTCGTT TGGTTGGTGCGCCTCCGGGATATGTCGGTTATGAAGAAGGTGGCTACCTGACCGAAGCGGTGCGTCGTCG TCCGTATTCCGTCATCCTGCTGGATGAAGTGGAAAAAGCGCATCCGGATGTCTTCAACATTCTGTTGCAG GTACTGGATGATGGGCGTCTGACTGACGGGCAAGGGAGAACGGTCGACTTCCGTAATAACGGTCGTCATTA TGACCTCTAACCTCGGTTCCGATCTGATTCAGGAACGCTTCGGTGAACTGGATTATGCGCACATGAAAGA GCTGGTGCTCGGTGTGGTAAGCCATAACTTCCGTCCGGAATTCATTAA   tm값도 생각해야하고 시작코돈 (?)도 있어야 한다고 들었는데 primer을 수기로 짜는 방법 아시는 분 계실까요,,? 초짜라 너무 어렵고 머리가 아픕니다..도와주세여ㅜㅜㅜ
회원작성글 체리망규  |  03.22
Q. 항생제가 들어간 LB배지 관련 질문입니다.
간단한 질문입니다. 실험 수업 처음이라 생초보 질문이라는 점...양해 드려요. 오늘 실험 수업에서 LB배지를 만들고 kanamycin이 들어간 배지와 들어가지 않은 배지를 따로 만들어 E.coli를 배양하는 실험은 하였는데요. 조교님께서 어떤 plate에 배양된 colony를 따서 streaking하라 하셨습니다.  배양 후, 다음날 모두 colony가 생겨 kanamycin에 대한 저항성을 가진 아이라는 것을 알게 되었습니다.  여기서 궁금한게, 제가 받은 E.coli는 이미 형질 전환이 된 E.coli를 받은 것인가요? 즉, 형질전환을 시키고, transduction을 한 후 spreading된 아이들을 제가 따낸 것인가요?  답변주시면 정말 감사하겠습니다.
회원작성글 미생미생물  |  03.22
Q. miniprep 후 enzyme cutting 했는데 gel에서 vector target size 바로 아래에 밴드가 떴는데 무슨 밴드일까요??
miniprep 후 NotI과 EcoRI로 ezyme cut 했구요. vector는 pGEM T-easy vector입니다.   그러고 나서 gel loading 했는데  vector size (3kb), insert size (1.6 kb)는 잘 떴거든요 근데 vector 아래에 non target band가 떳는데 저게 뭐 때매 뜬걸까요?? 제가 생각하기로는 NotI와 EcoRI 모두 pGEM T-easy vector에서는 two cut을 할 수 있다보니 enzyme cut때문에 저렇게 나오지 않았을까 싶은데... 이게 맞는 생각인지는 모르겠네요..ㅠㅠ 고수님들의 지혜를 나눠주세요..!!
회원작성글 soor  |  03.17
Q. 제한효소처리 시 DNA농도에 따른 DNA의 양
안녕하세요. 분자생물학에 관심이 많아 공부를 시작한지 반년?정도 된 문과출신 일반인입니다. 전반적인 과학에 대한 지식이 아주 많이 부족한점 미리 양해부탁드립니다. bBT7-N-his에서 플라즈미드를 추출하고  플라즈미드 농도가 conc 9.5가 나왔습니다. 이때 제한효소처리시 DNA 10.53 ul + EZ buffer 5 ul + enzyme 1 ul + 나머지 DW로 Total vol 50ul을 맞추려고 하는데요 이때 DNA의 농도(이부분을 어떻게 지칭할지 몰라서..)가 100ng로 맞춘게 맞을까요? 농도와 DNA투입양의 상관 관계를 알고싶습니다..
회원작성글 대왕초보맨  |  03.17
Q. 발현 벡터 관련 문의 (pCMV-SPORT6)
안녕하세요 분자생물학 경험이 거의 없는 초보 대학원생입니다...ㅠㅠ 한국인간유전자은행에서 다음 벡터를 분양받으려고 하는데요 genbank.kribb.re.kr/resource/mouse/view?id=mMU004396 이 벡터는 mouse cDNA이지만 pCMV-SPORT6 벡터에 클로닝 되어있습니다 cDNA로 제공하지만 pCMV 벡터라 바로 사용이 가능할 것 같아서 여쭤봅니다 혹시 이 cDNA vector를 mammalian cell에 바로 transfection해서 사용하여도 발현이 잘 될까요??
회원작성글 dr.med.vet..  |  03.10
Q. 시퀀싱 결과 해석
cloning진행 중 primer binding을 확인하기 위해 gel을 내렸고, 밴드가 잘 떠서 시퀀싱 업체에 보냈다가 결과를 받았습니다. 내가 원하는 유전자가 잘 따졌는지 확인하기 위해서는  -시퀀싱 peak확인 -시퀀싱 결과로 받은 서열과 내가 가지고 있는 서열 일치하는지 비교 를 해야 한다고 기억합니다.   제가 궁금한 것은 peak부분의 서열을 복사해서, 가지고 있는 서열과 비교하면 일치하는 부분이 없어서 이를 어떻게 해야 할 지 막막합니다ㅠㅠㅠ blast돌려 보면 사용한 종과 일치하는데.. 무엇이 문제인지.. 결과 해석이 처음이고 주변에 도움을 청할 곳이 없어 올려봅니다. 기초적인 질문 죄송합니다. 
회원작성글 전복죽  |  03.09
이전  01 02 03 04 05 6 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
진스크립트 광고