[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
국립암센터
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
[우당탕탕 석사 적응기] 석사 1학기 - 새로운 환경, 그리고 후회
전체보기 안전점검 LABox
 카테고리: 전체 > Molecular Biology-DNA > Sequencing
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. dna extraction kit 의 application 범위에 관하여
dna extraction kit 를 찾아보던 중 application 목록 중에 amplification 은 있었으나, sequencing 은 적혀있지 않은 kit 를 보게 되었는데요,   보통 DNA extraction 후 PCR 을 거친 다음 sequencing 을 진행하므로, amplification 이 가능하다는 것은 sequencing 도 가능하다는 건가요?
회원작성글 움가  |  2021.08.23
Q. 박테리오파지 DNA 추출 첨부파일
안녕하세요. 대학원에서 박테리오파지로 실험을 하고 있는 학생입니다. 다름이 아니오라 제가 분리한 박테리오파지의 genome sequencing을 위해 DNA를 추출하는 과정에서 거듭되는 실패로 인하여 저보다 경험이 많으신 분들의 도움을 얻기위해 글을 작성하게 되었습니다. 현재 제가 직면하여 가장 어려움을 느끼고 있는 문제는 multiband가 발생하는 것 입니다. 예시로 제가 sequencing을 의뢰한 업체에서 보내온 QC 결과를 첨부하였습니다. (RNA contamination은 rnase로 해결하였습니다.) 1 - 5번 샘플은 모두 norgen사의 bacteriophage DNA kit를 사용하고 동일한 과정을 거쳐 얻은 DNA 샘플입니다. 그러나 4, 5번 샘플은 multiband가 발생하지 않았지만, 1, 2번 샘플은 중간에 multiband가 발생하였습니다. 1, 2, 3번 샘플과 4, 5번 샘플의 차이점은 host bacteria가 다르다는 것 뿐입니다. 혹시 서로 다른 bacteriophage가 혼합되어 multiband가 형성되는가 싶어 수회에 걸쳐 single plaque를 얻은 후 DNA를 다시 추출하여도 똑같은 위치에 똑같이 multiband가 형성이 됩니다. 도대체 이 multiband가 나오지 않게 하려면 DNA를 어떻게 준비하여야 할까요.. 지금 sequencing이 급한데 동일한 문제가 반복하여 발생하니 답답하고 미칠것 같습니다. 제가 해본 노력은 1. 수회에 걸쳐 단일 파지를 얻은것 2. 사용하는 kit에 포함되어있는 buffer들이 오염되었을까봐 kit를 새롭게 구매하여 사용한 것 3. 사용하는 기구들로 인한 DNA의 contamination을 염려하여 기구를 닦은것 입니다. 제가 노력한 방법으로는 도저히 kit로 추출한 DNA에서 발생하는 multiband의 해결방안이 보이지 않아 PCI로 DNA를 추출하기 위해 준비를 마쳐놓은 상태입니다. 그러나, 거듭되는 실패로 점점 자신감이 떨어져 추출 방법을 바꿔도 문제가 해결되지 않을 것이라는 생각이 저를 지배하고 있습니다. 위 문제를 해결하기 위한 조언을 주신다면 대단히 감사드립니다...  
회원작성글 황백순  |  2021.08.20
Q. 시퀀싱(sequencing) 분석 방법
안녕하세요 대학원 석사과정을 하고 있습니다. 정말 너무 기초적인 질문이라 얘는 어떻게 대학원 진학을 한건지 의문이 드실수도 있지만 정말 부끄럽지만 다시 공부하려 전공책을 다시 구매를 했고 공부중에 있습니다. 현재 클로닝 과정은 열심히 하고 있으나 맞게 클로닝 된건지 시퀀싱 분석만 하면 스트레스를 받아 온몸에 식은땀이 나고 스트레스로 잠을 이루지 못합니다. 선배들에게 여쭤봐도 하루이틀 물어봐야지 매번 여쭤보려니 눈치보여서 공부를 하려는데 정확한 read방법 조차 몰라 결국 여기에 질문합니다. 현재 mutalin과 snapgene을 이용하여 시퀀싱 비교를 하는데, 선배 말로는 CDS(ORF)서열을 나열하고 시퀀싱이 맞지 않는 부분이 3배수로 끝나는지 확인, 그리고 염기가 바껴도 같은 protein으로 바뀌는 서열인지 확인, chromatogram을 보고 중첩되는지 확인. 이라고 배웠는데 앞,뒤로 mix match되는 서열은 5-90bp되서 날린다 해도 중간 read부분이 frameshift나 insertion이 생기면 이때는 어떻게 해석을 해야하는지 도통 모르겠습니다.. 가끔 deletion&insertion이 되도 어찌저찌 해결방안 찾아서 그 벡터 사용이 가능하던데.. 그 해결방안이 뭔지 모르겠습니다. 제가 생각한건 앞에 deletion이 하나 되도 바로 뒤 서열이 같고 뒤에 insertion이 되어도 같은 코돈으로 대체가 가능한 서열이 들어오는 방법이라는 것입니다. 또한 프로모터 부분에 서열이 크게 잘못되어도 상관없다라는 얘기를 들었는데 왜 상관이 없는지, 그렇다면 상관없는 region은 어디인지도 모르겠습니다.. binding domain은 이상이 생기면 안될거같은데 termainator region에도 이상이 생기면 안되는게 아닌지, 구체적으로 프로모터에 insertion&deletion이 생겨도 왜 이상이 없는건지 도통 모르겠습니다. 많이 답답하고 얜 뭐가 싶으실수 있습니다. 관련된 사이트 소개도 정말 괜찮고 시간내서 답변주시면 정말 너무너무 감사드리고 싶습니다.
회원작성글 살려주세요흑흑  |  2021.08.16
Q. Co1 시퀀스 co1+c02 시퀀스 alignment 하는법
동종의 2개의 co1 서열을 alignment해서 비교하려하는데요. 하나는 657bp의 co1 서열 다른 하나는 1601bp의 co1,co2 서열입니다. 1601bp중 co1은 1~879bp까지라고 ncbi에 써있는데 Mega로 alignment 해보니까 동종인데 서열이 많이 다릅니다. 1601bp를 어떤 작업을 해서 co1부분만 657bp의 co1 서열과 비교할 수 있나요? 서열을 아래 적어두겠습니다. ACATTTATATTTTATCTTTGGTGCATGAGCGGGAATAATAGGAACTTCATTAAGCATACTAATTCGTATAG AATTAGGTTCCCCAGGATCATTAATTGGTGATGACCAAATTTATAATGTTTGTAACTGCTCATGCATT TGTCATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCATTAATA TTAGGTGCTCCAGATATAGCTTTCCTCGAATAAATAATAATAAGATTTTGATTATTACCTCCCTTCATTAA CATTACTTCTAATAAGAAGAATAGTTGAAAGAGGGAGCTGGTACTGGTTGAACAGTTTACCCTCCTTTATC TTCCGGAATTGCCCATAGAGGTTCATCAGTAGACTTAGCAATTTTCAGATTACATTTAGCAGGAGTTTTCA TCAATTTTAGGTGCAGTAAATTTTATTACAACAATTATTAATACGACCAGCAGGAATAACTTTTTGATC GAATACCTTTATTTGTATGATCAGTTGGAATTACCGCTTTTATTACTTTTTATCATTACCTGTTTTTAGC AGGAGCAATTACAATATTATTAACAGATCGGAATTTAAATACATCATTTTTGATCCAGCAGGAGGAGGT GATCCAATTCTTTATCAACACTTATTT CCAGCAGGGGGAGGTGATCCAATTCTTTATCAACACTTATTTTGATTTTTTGGTCACCCTGAAGTTTTATA TTTTAATTTTACCAGGATTTGGAATTATTTCCCATATTTAGTCAAGAAAGAGGTAAAAAGGAAACTTT TGGATCATTAGGAATAATTTATGCTATACTTTCTATTGGATTATTAGGATTTATTGTATGAGCTCACCAT ATATTTACTGTTGGAATAGATGTTGATACTCGAGCTTATTTTACTTCAGCAACAATAATTTGCTGTTC CCACAGGAATTAAAATTTTTTCATGACTTGCAACTCTTCATGGTGCTCATTTAACTTATAGACCTTCATT ATTATGAGCATTAGGATTTGTTTTCTTATTTACAGTTGGGGGATTAACAGGTGTAGTTTTAGCTAATTCC TCAATTGATATTGTTTTACATGATACATACTATGTTGTAGCTCATTTTCACTATGTTCTTTCAATAGGAG CTGTATTTGCAATTATAGGTGGATTCATTCATTGATATCCATTATTTACTGGACTTACAATAGATAGAAA ATTATTAAAAATTCAATTTATTATCATTTATTGGAGTAAATACAACATTTTTTTCCTCAACATTTCTTA GGTTTAAGAGGTATACCACGACGATATTCTGATTATCTGATGCATACACTGCATGAAATGTTTGTTTCTT CTATTGGATCAATGATTTCATTTATTGGTATTTTATTTTTTTTATATTATATGAGAAAGAATAATTAC ACAACGAACTGTAATTTTTTAATCATATTTCATCTTCAATTGAATGACTTCAAAGTTATCCACCTGCT GAGCACAGATATTCTGAACTTCCAATACTTACTAATTAACATATTCTAATATGGCAGAATAGTGCAATGA ATTTAAGCTTCATATATAAAGTTTTACTTTTGTTAGAAAATGTCGACATGATCGGATTTAAATTTACAAG ACAGTTGCTCTCCAGTTATAGAACAATTATCTTTTTTTTCATGATCATACTATATCAATTTTAACTATAAT TACTATAGTAGTAGGTTATTTAATAATGACATTTTTAAAGATAAAAATATTAACCGTATACTTCTTGAA GGACAAATACTTGAATTAATTTGAACAATTCTTCCTGCAATTACATTAATTTTTATTGCTTTACCATCAC TTCGTCTACTTTATATTTATTGAAGAAATTATTAATCCTTTAATTACATTAAAATCATTGGACATCAATG ATATTGAACTTATGAATATTCAGATTTAATAATATTGAATTTGATTCATATATATTTCTTCAACTGAA TTAACTCCAGAAAATTTTCGATTATTAGATGTAGATAATCGAGTAATTTTACCATTAAAATCTCAAATTC GAGTATTAGTTACAGCAACAGATGTAATTCATTCATGAACAGTAACCAACTCTAGGAGTTAAAATTGATGC AACTCCTGGTCGTTTAAATCAAACTAATTTTTTTATAAATCGAACAGGATTTTTTTGGCCAATGTTCT GAAATCTGTGGTGCAAATCATAGATTTATGCCAATTGTTCTTGAAAGAATTCCATCAAATT
회원작성글 .학부생.  |  2021.08.15
Q. NCBI BLAST 해석 관련 질문드립니다
안녕하세요 ncbi blast 해석 관련 문의드립니다 제가 가지고 있는 쿼리로 블라스트를 돌렸고 Total score가 가장 높은 균을 A, 제가 원하는 균을 B라 하면 total score가 가장 높은 균은 A가 나왔지만 percent identity순으로 정렬했을땐 B가 100으로 가장 높은 순위가 나왔습니다 A또한 Identity가 99.8이상의 값을 보이지만, B의 Query cover가 95%로 다른 결과값들에 비해 낮은편으로 나왔습니다 혹시 저러한 결과로 봤을때 제 쿼리를 B로 판단해도 되는걸까요?? BLAST 관련 지식이 너무 없어 구글링하는 와중에 질문드립니다ㅜㅜ
회원작성글 유토리  |  2021.07.26
Q. 시퀀싱 크로마토그램 double peak 관련 질문입니다.
    안녕하세요, 현재 분리균주의 DNA에 대해 Prep, PCR까지 마친후 시퀀싱 업체에 의뢰하여 결과를 얻어 데이터를 만드는 과정에 있는 석사과정생입니다.   시퀀싱 업체에서 준 크로마토그램 데이터의 peak를 리딩하는중에 궁금한것이 있어 질문드립니다.   일반적으로 PEAK가 하나씩 깔끔하게 뜨는것이 가장 이상적인데, 어떤 균주는 두가지 이상의 균이 섞여있는것인지 전반적으로 double peak 양상이 나타나는데요. BLASTN을 시도하였을때, Query coverage 97%, Identity 96%로 확인되었습니다. 이러한 경우 데이터를 가공해서 써도 상관없을까요? 아니면 처음부터 다시 시작해서 시퀀싱을 재의뢰하는것이 나을까요?
회원작성글 당무당  |  2021.07.15
Q. oligo 합성 업체 (해외)
안녕하세요. 해외에 oligo 합성 하는 업체 여러 군데 알려주시면 감사하겠습니다.
회원작성글 yoho  |  2021.07.09
Q. 같은 균주인데 시퀀싱 결과가 다르게 나올수있나요?
  안녕하세요, 시퀀싱 결과에 대해 궁금한 점이 생겨 브릭에 질문 남겨봅니다.   균주 10개정도를 선정하여 시퀀싱 의뢰하였고, BLASTN 결과로 모두 동일하게 Bacillus cereus로 확인되었습니다. 당시 10개를 랜덤으로 선정하였는데, 모두 동일한 결과가 나온것이 이상하다고 판단이 되었고, 이중 5개만 랜덤으로 선정하여 prep부터 다시 진행하여 시퀀싱 재의뢰하였습니다.   첫번째 의뢰와 두번째 의뢰에서의 차이점은 prep kit를 새로 구매하여 진행하였다는 것입니다. 첫번째 의뢰당시, prep kit는 연구실에 구비되어있던것인데, 사용 기한이 다소 지난 제품이긴 했습니다.. 두번째 의뢰에 이용한 kit는 동일한 kit를 재구매하여 받은 새제품입니다.   두번째 의뢰 시퀀싱 결과에는 Bacillus strain으로 분류가 되나 haikouensis, amyloliquefaciens 등의 다른 결과도 얻을수있었습니다.   prep할때마다 시퀀싱 결과 또한 다르게 나올 가능성이 있나요? 염기서열이 다르면 이런 결과가 초래되기도 하나요?    
회원작성글 당무당  |  2021.06.28
Q. 시퀀싱에 대해서 궁금증이 생겨서 다시한번 글을써봅니다
저번에도 질문을 올렸던 실험실에 대학원생이 없는 학부생입니다! 실험진행중에 한가지 의문이 생겨서... 답변기다리겠습니다 !!! 3천bp 크기의 시료를 시퀀싱해서 파일을 받았는데  절반정도인 1600bp만 결과가 나온거에요 맡긴회사에 전화해보니 3천이넘으면 다 나오긴 힘들고 1500정도만 나올수 있다고 하더라구요 그래서 이부분을 프라이머를 다시 짜서 붙일려고 생각중인데 포워드 부분에 해당하는 프라이머쪽 염기서열 800쯤과 리버스 부분에 해당하는 프라이머쪽 염기서열 800쯤이 있어요 지금 그런데, 여기서  예를들어  포워드의 atgcatgc 리버스의 atgcatgc  이라면 1. 두개를 이어붙인다고 할때 atgcatgcatgcatgc 라고 임의로 이어붙이고 프라이머를 다시 만들어서 진행하면 중간쪽 안나온 부분이 나올까요? 1-1. 이걸 생각한 이유가 PCR을 하면 진행 방향이 반시계방향이잖아요(미토콘드리아 DNA에서) 반시계방향으로 진행되니까 오차가 생기지않을까해서요... primer walking도 찾아봤는데 저희 교수님의 취지는 그게 아니어서 직접 이어붙이는것을 목표로 해보라고하셔서요  
회원작성글 노예  |  2021.06.16
Q. 학부생 DNA 전기영동 전 DNA를 추출하는 과정 중 질문드립니다
DNA 추출 과정을 실험 목적과 기관마다 다 다르게 하는 것 은 알고있습니다.  저희가 했던 과정은  1. proteninase k를 1.5ml tube에 넣는다 2. whole - blood 200ml를 1에 넣는다 3. GB buffer 200ml를 2번에 넣는다 4. 60c incubate에 10분동안 5. 400ml의 무수에탄올 넣은 후 pipette으로 섞는다 6. Binding colum tube에 옮겨담는다. 7. 8000rpm 원심 1분 8. 하층액 제거 9. Wa1 500ml 넣고 원심 1000rpm 1분 후 하층액 제거 10. Wa2 500ml 넣고 원심 8000rpm 1분 후 하층액 제거 11. 남은 buffer 제거(1분 13000rpm) 12. Ea 100ml 넣고 1분 13. 8000rpm 1분 이런 과정인데 여기서 proteinase k 는 단백질 분해효소 GB buffer는 세포 깨주는 용도, 무수에탄올은 DNA가 물에 녹지않게해주는 용도 까지는 찾을 수 있었는데 12번에 Ea100ml를 넣는 이유를 알고 싶습니다. 9~11까지 buffer나 불순물을 제거했으니 Ea라는것이 DNA가 잘 붙어있나 확인할 수 있는? 아니면 DNA를 colum tube에 더 확실이 묶는 용도? 인지 확신이 서지 않아 이렇게 질문 드립니다
회원작성글 죄송하지만  |  2021.06.12
Q. 시퀀싱 의뢰시 결과가 잘못 나올수도있나요?
  안녕하세요, 해양생물 균주에서 채취한 균주를 가지고 DNA 프렙후 PCR까지 진행한다음 15개 가량 시퀀싱 업체에 의뢰를 맡겼습니다. 15개 균주에 대한 BLASTN 결과가 모두 Bacillus cereus strain 으로 동일하게 나옵니다..   그래서 업체측에서 제시해준 raw data를 가공한후 BLASTN과 Clusal omega까지 비교해보았는데, 동일한 결과가 나오네요..   이런 결과가 나올수있나요? 업체측에서 peak를 잘못 읽을 가능성도 있는건가요? prep하기전, morphology, color도 다른 양상을 띄기 때문에 같은 균주라고 보기엔.. 무리가 있다고 판단이 됩니다. 원인이 어떤건지 알수가 없네요...ㅠ
회원작성글 당무당  |  2021.06.06
Q. 시퀀싱 보내기 전 보관방법
시퀀싱 할 검체에 대해 PCR 한 후  Gel extraction 했습니다. 후에 시퀀싱 할 검체를 현재 냉동(-21도 )보관중인데, 나중에 시퀀싱을 의뢰 할 것 같습니다. (약 한달 정도)   계속 냉동 보관 해도 되나요? 아님 디프리저에 보관해야 하나요?      
회원작성글 면역쟁이  |  2021.05.25
Q. sample별 library가 다를 시 어떤 문제가 있는지
안녕하세요 같은 DNA 생산날짜가 다른 library로 시퀀싱할 때 나온 데이터 분석시 문제점, 차이점 등을 알고 싶습니다. 
회원작성글 dlkdakl;d  |  2021.05.23
Q. DNA 추출 후 전기영동2 (speed님께 질문 드립니다.) 첨부파일
스피드님. 항상 답변 감사합니다. ^^   어제 스피드님의 조언을 참고하여 B,C,D 샘플 -> DNA 5ul, 로딩버퍼 4ul, DDW 24ul 전기영동(겔2% 사용) 하였습니다.  (추가로 샘플 D도 같이 전기영동 함.) 첨부사진 올립니다.  사진을 보면 C에서만 희미하게 밴드가 보입니다. (500-400bp 사이에 밴드 보임)   궁금한 점은 1. C를 제외한 나머지 B,D는 왜 밴드가 안보일까요? 농도가 적어서 그런걸까요?  DNA 전기영동 시 가시적으로 볼 수 있는게 200ng 인데, B,C,D 모두 5ul 씩 넣었으니 B: 34.5ng, C:63ng, D:60ng 을 전기영동 했습니다. 그런데 C는 농도가 63ng으로  200ng보다 현저히 낮은데 전기영동에서 밴드가 보이는 이유가 뭘까요..? 2. C,D는 농도가 비슷합니다. 그런데 전기영동시 C는 밴드가 나왔고 D는 안나왔습니다. 농도가 비슷하므로 D도 밴드가 나와야하는 거 아닌가요?      * B,C,D 나노드랍 표 첨부합니다.   ng/ul 260/280 B 6.9 1.92 C 12.6 1.921.921.921.92 D 12 1.91  감사합니다. :)
회원작성글 면역쟁이  |  2021.05.21
Q. DNA 추출 후 전기영동 첨부파일
안녕하세요. 브릭 유저분들 질문이 있습니다. !   DNA Extraction 후 전기영동으로  밴드를 확인하고 있습니다. A,B,C 샘플이 있는데요.  모두 DNA band size 458bp 입니다. A샘플-> 퀴아젠 키트 사용하여 DNA Extraction 한 후 전기영동 한 결과입니다.  사진과 같이 500-400bp 사이에 밴드가 하나 떴습니다. (제가 원하는 결과입니다.) A샘플 나노드랍 결과 -> 농도: 57.0ng/ul  260/280: 1.9 입니다. 전기영동 조성은 겔 2% 사용했습니다. 그리고sample: 5ul, 로딩다이(6x buffer): 4ul, DDW: 15ul 토탈24ul 입니다.   그런데, B, C 샘플은 농도가 각각 6.9, 12.6ng/ul  입니다.  260/280: 1.9입니다.   농도가 A샘플보다 낮아서 전기영동 조성을 어떻게 해야 할 지 모르겠습니다. 일단, A샘플과 같이 겔2%, sample 용량: 5ul, 로딩다이(6x)4ul, DDW:15ul 넣을까 생각 중인데.. 괜찮을까요?   아시는 분 답변 감사드립니다.! p.s (sample 용량은 5ul 고정되야합니다. 샘플 양이 적어서요)       
회원작성글 면역쟁이  |  2021.05.20
Q. Plasmid 제한효소처리 전기영동 결과분석
             SDW 12ul Reaction Buffer 2ul    Plasmid DNA 5ul            Enztme 1ul             total  20ul  이렇게 mixture을 만들어 전기영동을 하였습니다.   supercoiled 형태로 3000bp size에 분포 하고 있는 것 밖에 분석을 못하겠습니다. 이것이 벡터이고  1번 plasmid의 2000bp 쯤에 존재하는 밴드가 insert인가요 ?
회원작성글 나는양파링  |  2021.05.15
이전  01 02 03 04 5 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
진스크립트 광고