[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 sale 회원가입   로그인
BRIC홈 실험
어시스트바이오
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
과학으로 본 코로나19 (COVID-19)
전체보기 안전점검 논문교환 LABox
 카테고리: 전체 > Molecular Biology-DNA > PCR/RT-PCR/Q-PCR
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. Pcr Primer Design에 관해 질문드립니다.
Foward : 3' - CGTTTCGACGACGACAAGCCG - 5' Reverse : 5'..
회원작성글 New_H  |  2020.11.11
Q. gapdh undetermined 첨부파일
사진에서 보시다시피 GAPDH 값만 undetermined로 떠요.... cDNA가 합성이 안..
회원작성글 o_o  |  2020.11.11
Q. enzyme cutting 후 PCR
enzyme cutting (one cut) 한 후 에 enzyme 불활성화 65도씨 20분한 후..
회원작성글 쏭달쏭알  |  2020.11.10
Q. vector pcr 시 size
형광유전자가 나오게 insert 시킨 vector를 pcr했는데 사이즈가 여러개 나왔어요ㅜ 원밴드..
회원작성글 유유가족  |  2020.11.09
Q. 유전자 deletion 후 확인 PCR multiband
  deletion casette를 만들어서 유전자 deletion한 뒤 gD..
회원작성글 도오ㅏ주세요  |  2020.11.06
Q. PCR 커브 설정을 잘못했는데요 ㅠㅠ
qRT-PCR할 때 PCR과정이 다 끝나고 마지막에 온도를 4도로 내려줘야 하는데 40번 반복..
회원작성글 Qupi  |  2020.11.06
Q. 전기영동 질문드립니다! 첨부파일
안녕하세요. 실험실에서 mycoplasma 부정 시험을 진행하고 있습니다. 처음에 1.5..
회원작성글 엔도톡신  |  2020.11.06
Q. genotype PCR 공부중인 학생입니다.
mouse genotype PCR을 공부하는 학생입니다. Mendelian ratio 와 관련..
회원작성글 조직방학생  |  2020.11.05
Q. UDG PCR에 대해서 알려주세요.
UDG PCR 자체는 이해했습니다. dUTP를 넣어서 UDG 로 가수분해하여 carry over를..
회원작성글 라떼이모  |  2020.11.05
Q. pcr 시 최종단계에서 온도 낮추는 이유가 궁금합니다.
안녕하세요. pcr 실험 중에 cycle을 돌려서 dna 를 증폭 시킨 후에 정말 마지막 단계에서..
회원작성글 whoru  |  2020.11.04
Q. pcr band가 희미하거나 아예 없을 때
hacat cell로부터 추출한 RNA로부터 cDNA를 합성하여 GAPDH 발현이 잘 되는 것을 확..
회원작성글 아기고양이  |  2020.11.03
Q. PCR multiple band
두번째 레인이 control이고 나머지가 클로닝 한 것에서 insert PCR을 진행한건데..
회원작성글 빙슈슈  |  2020.10.29
Q. Taqman probe에 대해 질문 드립니다.
제가 Taqman probe를 제작하려고 하는데 기존에는 SNP를 구분하는 probe가 아닌 일반적..
회원작성글 꼬승  |  2020.10.29
Q. overlap pcr 하고 gel extraction하여 phusion polymerase 이용해서 증폭하였는데 문제가 있습니다
앞뒤 500 bp짜리를 Q5 polymerase를 이용하여 overlap pcr 진행하였습니다...
회원작성글 asdfdsa321  |  2020.10.29
Q. Real time PCR 시 standard curve
안녕하세요 최근 qPCR을 진행중인데 Standard curve가 왔다갔다 거려서 어려움을 겪고 있..
회원작성글 coconacoco  |  2020.10.27
Q. 2.4kb DNA PCR 조건질문드려요 !!
2.4kb 정도 되는 상대적으로 긴 DNA를 PCR하고 있는 학생입니다 ㅜ Vibrio gen..
회원작성글 감감선  |  2020.10.27
이전  01 02 03 04 5 06 07 08 09 10  다음
공지사항
2020년 실험 Q&A 우수 참여자 선정 안내.
2019년 실험Q&A 우수답변자 안내
실험Q&A 게시판 편집기 변경
실험관련연재
박은총 연재중후배에게 주고 싶은 면역학 노트
박은총(Duke University)
신코 연재중분석장비 이야기
분석장비 탐험가 (필명) ((주)신코)
Mr.S 연재중의학계의 Spectaculum: 임상시험
Mr. S (필명) (연세대학교)
에스프리 연재중실험을 해봅시다
에스프리 (필명)
곽민준 연재중랩노트
곽민준 (POSTECH 생명과학과)
이제욱 연재중생명과학자 기초체력 다지기
이제욱 (오송첨단의료산업진흥재단, 신약개발지원센터)
금주의 인기Q&A
NaOH도 오염이 되나요? [5]
논문을 읽다가 저 문장이 이해가 안되네요.. [1]
마트리젤의 정확한 용도를 알고 싶습니다. [2]
단백질 정제 후 dimer band가 나왔는데 어떻게 해야되나요? [5]
pcr산물 전기영동 결과 흐릴때 [2]
S.cerevisiae에서 ubiquitin-proteasome말고 다른... [1]
단백질이 tetramer 되는 이유 [1]
Cell seeding [4]
고체배지 만들때 Agar 함량 [1]
DNA 농도에 따라 Kd 값이 달라지는 게 말이 되나요..? [3]
최근답변자 우수답변자
알PDpotter

알UoUz

대왕개구리SPEED

뒷다리imperialve..

올챙이녀냥

개구리동물연구

알오늘도쾌변

올챙이soonlok

꽃개구리visavis

꽃개구리Baltimore

개구리bio

개구리남녀칠세마동석

대왕개구리SPEED

꽃개구리juno

개구리빛초롱

개구리곰돌2

위로가기
실험 홈  |  실험FAQ  |  실험 문의 및 제안
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의 member@ibric.org
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
에펜도르프코리아 광고