[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
국립암센터
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
[우당탕탕 석사 적응기] 석사 1학기 - 새로운 환경, 그리고 후회
전체보기 안전점검 LABox
 카테고리: 전체 > Molecular Biology-DNA > Sequencing
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. 염기서열 공통점 분석
제가 재생생물 위주로 공통된 염기서열을 분석하는 연구를 하고 있는 고등학생입니다. 플라나리아와 도마뱀, 불가사리, 인간의 염기서열에서 공통점을 조사해 재생하는 유전자를 파악하는 연구를 하는데 어떤 염기서열이 재생유전자 발현에 영향을 미치는지 알 수 있는 방법이 있을까요? CLUSTAL 2.1 Multiple Sequence Alignments Sequence type explicitly set to DNA Sequence format is Pearson Sequence 1: ours 385 bp Sequence 2: mexicana 759 bp Sequence 3: japonica 1521 bp Sequence 4: benazzii 664 bp Sequence 5: hepta_italy.freshwater_ 706 bp Sequence 6: dorotocephala_America_ 1332 bp Sequence 7: ryukyuensis_japan_ 1335 bp Sequence 8: sicula_Mediterranean_ 480 bp Sequence 9: aethiopica 480 bp Sequence 10: subtentaculata_south 649 bp Sequence 11: notogaea_east 480 bp Sequence 12: Scincella 1041 bp Sequence 13: Spirogyra_suncam_ 860 bp Sequence 14: Asteroidea_starfish_ 655 bp Sequence 15: homo 495 bp Start of Pairwise alignments Sequences (1:2) Aligned. Score: 19.7403 Sequences (1:3) Aligned. Score: 85.1948 Sequences (1:4) Aligned. Score: 63.6364 Sequences (1:5) Aligned. Score: 64.9351 Sequences (1:6) Aligned. Score: 52.2078 Sequences (1:7) Aligned. Score: 71.9481 Sequences (1:8) Aligned. Score: 33.5065 Sequences (1:9) Aligned. Score: 35.3247 Sequences (1:10) Aligned. Score: 59.7403 Sequences (1:11) Aligned. Score: 34.026 Sequences (1:12) Aligned. Score: 23.6364 Sequences (1:13) Aligned. Score: 22.3377 Sequences (1:14) Aligned. Score: 24.1558 Sequences (1:15) Aligned. Score: 21.039 Sequences (2:3) Aligned. Score: 19.7628 Sequences (2:4) Aligned. Score: 18.3735 Sequences (2:5) Aligned. Score: 18.272 Sequences (2:6) Aligned. Score: 11.3307 Sequences (2:7) Aligned. Score: 10.8037 Sequences (2:8) Aligned. Score: 20.625 Sequences (2:9) Aligned. Score: 20.2083 Sequences (2:10) Aligned. Score: 21.1094 Sequences (2:11) Aligned. Score: 20.2083 Sequences (2:12) Aligned. Score: 20.0264 Sequences (2:13) Aligned. Score: 20.8169 Sequences (2:14) Aligned. Score: 20 Sequences (2:15) Aligned. Score: 19.798 Sequences (3:4) Aligned. Score: 85.6928 Sequences (3:5) Aligned. Score: 85.9773 Sequences (3:6) Aligned. Score: 17.1171 Sequences (3:7) Aligned. Score: 22.9213 Sequences (3:8) Aligned. Score: 74.5833 Sequences (3:9) Aligned. Score: 74.5833 Sequences (3:10) Aligned. Score: 86.5948 Sequences (3:11) Aligned. Score: 82.0833 Sequences (3:12) Aligned. Score: 21.806 Sequences (3:13) Aligned. Score: 21.1628 Sequences (3:14) Aligned. Score: 51.9084 Sequences (3:15) Aligned. Score: 21.6162 Sequences (4:5) Aligned. Score: 95.6325 Sequences (4:6) Aligned. Score: 24.6988 Sequences (4:7) Aligned. Score: 35.8434 Sequences (4:8) Aligned. Score: 50.8333 Sequences (4:9) Aligned. Score: 51.6667 Sequences (4:10) Aligned. Score: 88.906 Sequences (4:11) Aligned. Score: 58.125 Sequences (4:12) Aligned. Score: 22.1386 Sequences (4:13) Aligned. Score: 18.9759 Sequences (4:14) Aligned. Score: 41.2214 Sequences (4:15) Aligned. Score: 19.596 Sequences (5:6) Aligned. Score: 22.8045 Sequences (5:7) Aligned. Score: 34.2776 Sequences (5:8) Aligned. Score: 55.625 Sequences (5:9) Aligned. Score: 56.4583 Sequences (5:10) Aligned. Score: 90.6009 Sequences (5:11) Aligned. Score: 65.4167 Sequences (5:12) Aligned. Score: 21.9547 Sequences (5:13) Aligned. Score: 20.255 Sequences (5:14) Aligned. Score: 43.0534 Sequences (5:15) Aligned. Score: 21.4141 Sequences (6:7) Aligned. Score: 15.4655 Sequences (6:8) Aligned. Score: 21.25 Sequences (6:9) Aligned. Score: 20.4167 Sequences (6:10) Aligned. Score: 26.0401 Sequences (6:11) Aligned. Score: 19.7917 Sequences (6:12) Aligned. Score: 7.39673 Sequences (6:13) Aligned. Score: 8.72093 Sequences (6:14) Aligned. Score: 13.4351 Sequences (6:15) Aligned. Score: 16.1616 Sequences (7:8) Aligned. Score: 24.7917 Sequences (7:9) Aligned. Score: 23.75 Sequences (7:10) Aligned. Score: 36.3636 Sequences (7:11) Aligned. Score: 25 Sequences (7:12) Aligned. Score: 8.83766 Sequences (7:13) Aligned. Score: 8.83721 Sequences (7:14) Aligned. Score: 14.1985 Sequences (7:15) Aligned. Score: 14.5455 Sequences (8:9) Aligned. Score: 92.7083 Sequences (8:10) Aligned. Score: 50 Sequences (8:11) Aligned. Score: 71.875 Sequences (8:12) Aligned. Score: 22.9167 Sequences (8:13) Aligned. Score: 21.0417 Sequences (8:14) Aligned. Score: 46.25 Sequences (8:15) Aligned. Score: 16.875 Sequences (9:10) Aligned. Score: 49.375 Sequences (9:11) Aligned. Score: 73.3333 Sequences (9:12) Aligned. Score: 21.0417 Sequences (9:13) Aligned. Score: 21.25 Sequences (9:14) Aligned. Score: 47.0833 Sequences (9:15) Aligned. Score: 17.5 Sequences (10:11) Aligned. Score: 58.125 Sequences (10:12) Aligned. Score: 21.8798 Sequences (10:13) Aligned. Score: 18.7982 Sequences (10:14) Aligned. Score: 40.2157 Sequences (10:15) Aligned. Score: 18.7879 Sequences (11:12) Aligned. Score: 22.9167 Sequences (11:13) Aligned. Score: 20.625 Sequences (11:14) Aligned. Score: 46.875 Sequences (11:15) Aligned. Score: 19.1667 Sequences (12:13) Aligned. Score: 20.5814 Sequences (12:14) Aligned. Score: 25.4962 Sequences (12:15) Aligned. Score: 19.798 Sequences (13:14) Aligned. Score: 19.8473 Sequences (13:15) Aligned. Score: 22.4242 Sequences (14:15) Aligned. Score: 21.2121 Guide tree file created: [clustalw.dnd] There are 14 groups Start of Multiple Alignment Aligning... Group 1: Delayed Group 2: Delayed Group 3: Delayed Group 4: Sequences: 2 Score:12388 Group 5: Sequences: 3 Score:11552 Group 6: Sequences: 4 Score:11551 Group 7: Sequences: 2 Score:8740 Group 8: Sequences: 3 Score:7424 Group 9: Sequences: 7 Score:5944 Group 10: Sequences: 8 Score:6366 Group 11: Delayed Group 12: Sequences: 2 Score:5857 Group 13: Sequences: 3 Score:5044 Group 14: Sequences: 11 Score:3139 Alignment Score 103800 CLUSTAL-Alignment file created [clustalw.aln] clustalw.aln CLUSTAL 2.1 multiple sequence alignment benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica -------------------------------------------------- sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ CGCAGT-------------------------------------------- dorotocephala_America_ ---GAT-------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica -------------------------------------------------- sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica -------------------------------------------------- sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica -------------------------------------------------- sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica -------------------------------------------------- sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica -------------------------------------------------- sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica ---------TTGTTTTCTACCAATCATAAGGATATTGGTACTTTATATTT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica TATTTTTGGCATCTTTATGGGTTTATTTGGTGGTTCTTTGAGTTTAGTTC sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica TTCGTCTTGAGTTGGCTAGTCCTGGTTCTTTATTAGGCAGGTTAAGTTTA sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------TTCGGCTCACTTCTAGGCC homo -------------------------------------------------- mexicana --------------------------------TCGAAACCTGCACAGCAG Spirogyra_suncam_ -------------TGACAACAAATGAACAAACCTACGGCTTTGGAATCCC benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica TATTATGGTATAATGACTGCTCATGGTTTAGTTATGATTTTTTTTTTTGT sicula_Mediterranean_ --------------------------------------TTTTTTTTTTGT aethiopica --------------------------------------TTTTTTTTTTGT notogaea_east --------------------------------------TTTTTTTTTTGT Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella TCTGCCTAATTGTACAAGTACTTACTGGGCTATTTCTAGCCATACACTAC homo -------------------------------------------------- mexicana AACAACCTGTGAACACGTTAAAAAATCTGGCCTTGCTTGGCCTAGAGCTC Spirogyra_suncam_ CGCCCACAGACTCCGAACTGCCTCCTTTGGTAGGGGTTCCTGCCCTGCAG benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica TATGCCTATTTTGATAGGTGGCTTTGGTAATTGGTTAATACC-TTTGATG sicula_Mediterranean_ TATGCCTATAATGATAGGCGGTTTTGGTAAATGGTTGATACC-TTTGTTA aethiopica TATGCCTATAATGATAGGTGGTTTTGGTAAATGGTTAATACC-TTTATTA notogaea_east TATGCCTATTCTTATTGGTGGTTTTGGTAATTGATTAATTCC-TTTACTT Asteroidea_starfish_ ------AATAATGATTGGTGGATTTGGAAACTGATTAATTCC-TCTAATG ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella ACAGCAGATATTTCTTCCGCTTTTTCATCTATCGCTCACATC-TGCCGCG homo -----------------TTCTCTCCGGGATACCCCAACGTCT-TTCCACA mexicana TTGCTCGAGCCTCGTGAGGCCTTGTCGGCTTGCATTCATKCT-TGCCCAC Spirogyra_suncam_ CCATGCCGCATCAAGCTGGCGTGGCAAGATGCTGTGACTGCTACGTCAGC benazzii -------------------------------------------------- hepta_italy.freshwater_ ---------------------------------------TTGAGTTTTTG subtentaculata_south -------------------------------------------------- japonica TTAGGTACTGTAGATATGGCTTTTCCTCGTGCTAATAAATTAAGTTTTTG sicula_Mediterranean_ ATAGGTTCAATTGATATGGCGTTCCCTCGTGCTAATAACTTGAGTTTTTG aethiopica ATTGGTTCTATTGATATGGCTTTTCCTCGTGCTAATAATTTGAGTTTTTG notogaea_east TTAGGTTCTGTTGATATGTCTTTTCCTCGTGCTAATAATCTTAGGTTTTG Asteroidea_starfish_ ATCGGAGCCCCAGACATGGCATTTCCTCGGATGAACAAAATGAGATTCTG ours -----------------------------------------------TTA ryukyuensis_japan_ ---------------------TTTTGGTTTTTTGGACATCCTGAAGYTTA dorotocephala_America_ ------------------------------------------GAGGTTTA Scincella ATGTACAATACGGCTG-ACTTATCCGAAACATTCATGCAAACGGGGCCTC homo GCCTCAGGGCCCAGGGTCCCCATCTACCTGAGCCAGGGCTACAGGTCTCC mexicana GCACGTGGGGCATCATGGATGTTAGGTCGGCACCCTAACAAACCCCCGGC Spirogyra_suncam_ TTCCCATGACAAAGAACAAAAAACTAACTCGGATGCGAATCATGTGCTCG benazzii -------------------------------TTTTCTGNTTTTTGTTATG hepta_italy.freshwater_ GCTTTTAATTCCTTCTGTTTTTTTGTTGGTTTTTTCTGTTTTTTGTTATG subtentaculata_south -------------------------------------GTGTTTTGTTACG japonica GTTACTAATACCATCTGTTACTTTTTTATTCTTTTCTGTTTTTTGTTTTG sicula_Mediterranean_ ATTATTAGTACCTTCAATATTGCTTCTCTTGTTTTCTGTTTTTTCAGAAG aethiopica GTTGTTGATACCTTCTATATTGCTTCTTTTGTTTTCTGTTTTTTCAGAAG notogaea_east ATTGTTGATACCTTCTGTTTTTTTGTTAGTTATTTCAGTGTTTTGTTATG Asteroidea_starfish_ ATTAGTTCCCCCATCCTTCCTTCTACTTATAGCCTCCGCCGGAGTTGAAA ours TATTTTAATAATTCCTGGGTTTGGTATTGTTTCACATTTGTGTATGTATT ryukyuensis_japan_ TATATTGATAATTCCAGGATTTGGAATTATTTCCCACCTTTGTATGTATT dorotocephala_America_ NATATTDACTCTNCCTGGATTTGGGATAATTTCACATATAGTGATNTMCT Scincella CATGTTCTTTATCTGTTTGTACCTACACATTGGACGAGGGCTTTACTACG homo CTTCTTCCCTCCTCAGCCCCTGGGACTCCACTCCCAGCTGCATCAGGAGC mexicana ACGGTATGTGCCAAGGAAAACTAAACTTAAAGGGCCCGTGCAACTTC--- Spirogyra_suncam_ CTGACGTGTCAGATGCCCGTGTGATGACATCAGAAGGGTCTGACAGAAAA benazzii GCGGGGTTGTGGCTGGTTGAACT--ATTTACCCTCCTCTTTCTTCTTTTA hepta_italy.freshwater_ GTGGGGTTGTAGCTGGTTGAACT--ATTTACCCTCCTCTTTCTTCTTTTA subtentaculata_south GTGGTGTTGTTGCTGGTTGAACT--ATTTATCCTCCTCTATCTTCTGGTA japonica GTGGTGTTATTGCTGGTTGAACC--ATTTACCCTCCTCTTTCTTCGATTA sicula_Mediterranean_ GTGGAGTAGTTGCTGGTTGGACG--ATATATCCTCCTCTTTCTTCTTTTT aethiopica GTGGTGTTGTTGCTGGTTGGACA--ATATACCCACCTCTTTCTTCTTTTT notogaea_east GTGGTGTTGTTGCTGGTTGAACT--ATATATCCTCCTCTTTCTTCTATTA Asteroidea_starfish_ GCGGTGCAGGTACAGGATGAACA--ATCTACCCTCCTCTATCTAGAGGAT ours ATAGTGGTAAGGAT----TTAGT--ATTTGGTCACATAGGTATGTTATTT ryukyuensis_japan_ ATAGAGGTAAGGAA----TTAGT--TTTTGGTCACTTGGGTATGTTGTTT dorotocephala_America_ ATACRGGTAAGTCT----AATTC--ATTTGGTCATYTGGGAATGGTYTDT Scincella GCTCTTATATATATAAAGAAACATGAAACATCGGGGTGGTTCTTCTACTG homo TCACAGTGATGACT----CCCTCCCACAGGCTTTTGTCTTTAAAATGAAT mexicana GTCCCGTTAGCGGTGTGCGTGTTGTACGTGGCGTCCT-TTTAAAACATAA Spirogyra_suncam_ GTGATACACGTGGAACTGAAAAACGACGGGTGTTTGTTTTCAAACATGAA * benazzii AGTA-------TTCTTCTGGT-ATTGGTTTAGATATGGCTATTTTGTCTT hepta_italy.freshwater_ AGTA-------TTCTTCTGGT-ATTGGTTTAGATATGGCTATTTTGTCTT subtentaculata_south AGTA-------TTCTTCTGGT-GTTGGTTTAGATATGGCTATTTTGTCTT japonica AGTA-------TTCTACTGGT-GTTGGTTTAGATTTTGCTATTTTGTCTC sicula_Mediterranean_ CTTA-------TTCTAGTAGT-TCTGGTTTGGATTTGGCTATTTTATCTT aethiopica CTTA-------TTCTAGTAGT-TCTGGTTTGGATTTGGCTATTTTATCTT notogaea_east AGTT-------TTCTGTTGGT-TTAGGTTTAGATTTAGCTATTTTTTCTT Asteroidea_starfish_ TAGC-------ACATGCTGGA-GGATCAGTAGATCTAGCAATTTTCTCTC ours GCTA-------TGTTGAGCATTGGCTTTTTGGGTTTTATTGTTTGGGCCC ryukyuensis_japan_ GCTA-------TGCTAAGAATTGGTTTTTTAGGTTTTATTGTTTGAGCAC dorotocephala_America_ GCGA-------TGGTTGCAATTGATTTTTTGGGTTTTATTGTGTGAGCGC Scincella CTTG-------TAATAGCAACCGCCTTTGTCGGCTATGTACTGCCTTGAG homo ATCA-------CAGCAGCTGTAGGGACTAAAGGAGGCGATGTCTGCAAAA mexicana ACGA-------CTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAG Spirogyra_suncam_ AGCAGGAGATTCGATCGGAGTAGTACCTGTCAACAACGATGTGCTGGTCG * benazzii TACAT-----ATTGCTGGTGCTAGTTCTATTTTA-GGTTCT---ATTAAT hepta_italy.freshwater_ TACAT-----ATTGCTGGTGCTAGTTCTATTTTA-GGTTCT---ATTAAT subtentaculata_south TACAT-----GTTGCTGGTGCTAGTTCTATATTA-GGTTCT---ATTAAT japonica TCCAT-----GTTGCTGGTGCTAGTTCAATTTTA-GGTTCA---ATAAAT sicula_Mediterranean_ TACAT-----GTTGCTGGTGCAAGTTCAATTTTA-AGTTCT---TTAAAT aethiopica TACAT-----ATTGCTGGTGCAAGTTCTRTTTTA-AGTTCT---TTAAAT notogaea_east TGCAT-----GTGGCAGGTATTAGTTCTATTTTA-GGTTCG---ATTAAT Asteroidea_starfish_ TACAC-----TTGGCTGGAGCATCCTCTATCCTG-GCATCA---ATAAAC ours ATCAT-----ATGTACGTTGTTGGTTTAGATTAC-GATACTCGTTCTTAT ryukyuensis_japan_ ATCAT-----ATGTATGTTGTAGGTTTAGATTAC-GATACTCGTKCCTAT dorotocephala_America_ ACCAT-----ATGTATACAGTAGGTATGGATTTT-GATTCTCGAGCTTAT Scincella GACAA-----ATATCATTCTGAGGTGCAACTGTC-ATTACA----AACCT homo GCAGTG----ATGGTTGTCAGCAGTGGAGTCTTCTGGAATCTCTAAGCCA mexicana AACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCA Spirogyra_suncam_ ACAGGT--TAATTTCAAGACTGAATGCAGTGGAAAGAAAAGGACAGGTGT benazzii TTTATAGTTACTATTTACGGTATGTCTAATTCTAATTTAGT------TAG hepta_italy.freshwater_ TTTATAGTTACTATTTATGGTATGTCTAACTCTAATTTAGT------TAA subtentaculata_south TTTATAGTTACTATTTATGGTATGTCAAATTCTAATTTGGT------AGG japonica TTTATTGTTACTATATATGGAATGTCTAATTGTAACCTTGT------TCG sicula_Mediterranean_ TTTATTGTTACGGTTTTAGGTTTGTCTGAGTTTAGTATGTC------TGT aethiopica TTTATTGTTACGGTTTTAGGTTTGTCTGAGTTTGGTATGTC------WGT notogaea_east TTTATTGTTACTATTTATGGAATGTCTGGATGTAAATTGGT------TCG Asteroidea_starfish_ TTTATAACAACAGTAATAAACATGCGTACTCCGGGAATATCCTTTGATCG ours TTTACAGCTGCTACTATGATTATTGCTGTTCCAACAGGTAT--TAAGGTT ryukyuensis_japan_ TTTACAGCTGCTACTATGATTATTGCTGTTCCTACTGGGAT--TAAGGTT dorotocephala_America_ TTTACRAGTGTGACAATRATTATNGGAGTGCCTACAGGGAT--AAAGGTG Scincella CCTATCGGCCGTACCGTACATCGGCACAAGTCTAGTAGAATGAATCTGAG homo TCTGGGGATGGAAATGTCACTGTGGGTGGGAGAGAGGAGGGGCTTTCCCC mexicana TCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGCT------GAG Spirogyra_suncam_ TCGAAGCAAAGTCGAATGACAATGATCA-GCCCACTCTCCTCCATATCAA benazzii ATTACCTTTATATTTGTGATCTTTATT-TATAAC---TTCTTGGTTACTT hepta_italy.freshwater_ ATTGCCTTTATATTTATGATCTTTATT-TATAAC---TTCATGATTACTT subtentaculata_south TTTGCCTTTATATTTATGGTCTTTGTT-TATAAC---TTCTTGGTTGCTT japonica CTTACCTCTATACCTGTGATCTCTTTT-TATAAC---TTCTTGATTGCTT sicula_Mediterranean_ TTTACCTTTGTATATTTGGTCTCTTTT-TATTAC---TTCTTGATTGTTG aethiopica TTTACCTTTGTATATTTGATCTCTTTT-TATTAC---TTCTTGGTTGTTG notogaea_east ATTGCCTTTATATTTGTGATCTCTTTT-TATAAC---TTCTTGGTTGTTG Asteroidea_starfish_ ACTACCACTGTTTGTATGATCAGTATT-CGTCAC---AGCCTTTCTCCTT ours TTTAGTTGAATT---GCTACTCTTTGT-GGTTCT----AGTTTTTTAGAT ryukyuensis_japan_ TTTAGTTGAATA---GCAACTCTTTGT-GGTTCT----GGTTTTCAAGAT dorotocephala_America_ TTTAGGTGGTTG---GCAACTTTGTAT-GGTGGT---YGGTTT----SAT Scincella GTGGGTTCTCAGTAGACAACGCAACAC-TAACTCGATTTTTTACCTTTCA homo GTGGCCTGGGCGCTGCCAGAGTCTTTCACATTGCCATGGTCCCAGGGTCT mexicana GGCACGTCTGCCTGGGCGTCACGCATCATGTCGCCCCCNAGCAGGCATCC Spirogyra_suncam_ ACAACCATGCTCTCTTCGTCATGCATTTCTTCATCACTGCGACATTACTT benazzii TTATT---------ATCTCTTCCTGTTTTAGCTGCTGCYTTAAC-TATGT hepta_italy.freshwater_ TTGTT---------ATCTCTTCCTGTTTTAGCTGCTGCTTTAAC-TATGT subtentaculata_south TTGCT---------TTCTCTTCCTGTTTTAGCTGCTGCTTTAAC-TATGT japonica TTGTT---------ATCACTTCCTGTTTTAGCTTCTGCTTTAAC-TATGT sicula_Mediterranean_ CTTTT---------ATCTCTTCCTGTTTTAGCTTCTGCTTTAAC-TATGT aethiopica CTTTT---------GTCTCTTCCTGTTTTAGCTTCTGCTTTAAC-TATGY notogaea_east TTATT---------ATCTCTTCCTGTTTTGGCTTCTGCTTTAAC-TATGT Asteroidea_starfish_ TTATT---------ATCCCTACCTGTTCTAGCCGGAGCCATAAC-AATGC ours TTATTTAGTCGTAGTGTTGTTGTTAATTGGTTGTTGGGTTTTAT-TTTTT ryukyuensis_japan_ TTG------------GTTGTTATAAATTGGTTATTAGGTTTTAT-TTTTT dorotocephala_America_ TTACT---------AACAATTTCTGTATGGGTGTTGGGGTTGAT-RTATA Scincella CTTTCTCCTCCC--TTTTGTCGTCATAGGGGCCTCTATACTGCA-TCTAC homo CTGATGGGT-----AAGCACGGTGGCGAGAGTGCAGGTTCTGGA-GAGGA mexicana CTTTKAAGGAAGCCTTTGGTTCGGGGCGGAGATTGGTCTCCCGTGCTTGT Spirogyra_suncam_ CCGTTCTGAA----GAAAGGACTCATTCGAACGCTTGCAGAGAGCTGTGA benazzii TGATTACTGATCGTAACTTTAATACYAGATTTTTTGATCCYAGAGGTGGT hepta_italy.freshwater_ TGATTACTGATCGTAATTTTAATACTAGATTCTTTGATCCTAGAGGTGGT subtentaculata_south TAATTACTGATCGTAATTTTAAAACTAGTTTTTTTGATCCTAGTGGTGGT japonica TGATTACAGATCGTAAATTTAAAACTAGTTTTTTTGATCCTAGGGGTGGT sicula_Mediterranean_ TGTTAACAGAYCGTAAATTGAAAACAAGTTTTTTTGATTCGGGGGGAGGC aethiopica TGTTGACAGATCGTAAATTGAAAACAAGTTTTTTTGATTCCAGGGGAGGT notogaea_east TAATTACTGATCGTAATTTAAATACTAGATTTTTTGATCCTAGTAGTGGT Asteroidea_starfish_ TACTAACCGACCGAAACATAAATACTACATTTTTCGACCCAGCAGGTGGA ours TGTTTACTATAGGTGGTTTAA---CTGGTTTGGTTTTATCAAATGCAAGG ryukyuensis_japan_ TGTTTACTGTTGGTGGTTTGA---CTGGTTTAGTTCTTTCTAAT------ dorotocephala_America_ CGTTWACTGTARGAAGGTRRA---CTGGAATTGTTCTATCGACTGCTTCT Scincella TGTTTTTACATGAAACGGGATCAAACAACCCAACCGGACTAACTTCAAAC homo GAGAGAGCCAGCCTGGGTTCAGATCCCATCTCTGGGAACTTACGCACTAT mexicana GGCGCGGCTGGCCTAAATAGGAGTCTCTTCAAGAGGGACGCACGGCTAGT Spirogyra_suncam_ GAATGAAAAGGAGAAGCATCGAATGCTTTTTCTTTG-CTCAAGAGGAGGA benazzii GGTGAYCCTTTATTATTTCAACATATGTTTTGGTTTTTTGGYCATCCTGA hepta_italy.freshwater_ GGTGATCCTTTATTATTTCAACATATGTTTTGATTTTTTGGTCATCCTGA subtentaculata_south GGTGATCCTCTTTTGTTTCAACATATGTTTTGATTTTTTGGACATCCTGA japonica GGTGATCCTGTTTTGTTTCAGCATATGTTTTGATTTTTTGGCCATCCTGA sicula_Mediterranean_ GGAGATCC------------------------------------------ aethiopica GGGGACCC------------------------------------------ notogaea_east GGTGATCC------------------------------------------ Asteroidea_starfish_ GGAGACCCAATTCTATTCCAACACTTATTCTGATTCTTTGGACACCCTGA ours TTGGATATTAGTTTG----------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ TCGGATGTTTGCTAACATGATACTTATTATGTS----------------- Scincella GCAGACAAAGTCCCATTTCACCCATACTACTCATA-TAAGGATCTCCTAG homo G-AGACCCTACGGAAATTATTTAATCCCTCTGAGC--------------- mexicana GGTGGTTGATAACACAGTCGTCTCGTGTCGTGCGTTTTCCTTCTTGTGCG Spirogyra_suncam_ AAGGATGCATATAAGACAGAAGTCCAGGATGCTAAATTAGGCATCGTTGA benazzii GGTTTATATTTTAATTATTCCAGGTTTTGGTATTGTTTCCCATTTGTGCA hepta_italy.freshwater_ AGTTTATATTTTAATTATTCCAGGTTTTGGTATTGTTTCTCATTTGTGCA subtentaculata_south GGTTTATATTTTGATTATACCTGGTTTTGGTATTGTTTCTCATTTGTGTA japonica AGTTTACATATTAATCATTCCAGGTTTTGGTATAGTTTCTCATTTATGTA sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ AGTATACATTCTAATACTTCCAGGATTTGGAATGATTTCTCATGTTATTG ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella GGGCTACATTATTTGTTATCTTCCTTATAGCCCTGGCCCTACTTTTCCCA homo -------------------------------------------------- mexicana TGGTGCTCTTATAAAACCCCGTTGTGTTGTCATTGTGATGATGCTTCGAT Spirogyra_suncam_ CTTTCTCGATCTTTTCCCCTCCTGTCATCCTCCTCTCCCTCACGTGTTCG benazzii TGTAYTATAGTGGTAAGGATTTAGTTTTTGGTCATTTAGGTATGCTTTTT hepta_italy.freshwater_ TGTATTATAGTGGTAAGGATTTAGTTTTTGGTCATTTAGGTATGCTTTTT subtentaculata_south TGCATTATAGTGGTAAGGATTTAATTTTTGGTCATTTGGGAATGTTGTTT japonica TGTACTATAGGGGTAAGGATTTAGTGTTTGGTCATTTGGGTATGTTGTTT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ CACACTACTCAGGAAAGACAGAACCTTTCGGTTATTTAGGAATGGTCTAC ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella AATCTACTAGGAGACCCAGAAAACTTTACCCCTGCAAACCCATTAGTTAC homo -------------------------------------------------- mexicana CGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATA Spirogyra_suncam_ ACCATCTTCCTCCTCTTGTCCCTCGTCTCTACTCCCTCTCCAACTCTCCC benazzii GCTATGTTAGGTATTGGTTTTTTAGGTTTTATTGTTTGAGCACATCATAT hepta_italy.freshwater_ GCTATGTTAGGTATTGGTTTTTTAGGTTTTATTGTTTGAGCACATCATAT subtentaculata_south GCTATGTTAGGTATTGGTTTTTTAGGTTTTATTGTTTGAGCACACCATAT japonica GCTATGTTAAGTATTGGTTTTTTGGGTTTTATTGTTTGAGCACACCATAT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ GCCATAATTTCAATAGGAATACTAGGATTCCTAGTATGAGCCCAC----- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella CCCACCACACATCCAACCAGAATGATACTTCCTCTTTGCATACGCTATTT homo -------------------------------------------------- mexicana AGCGGAGGAAAAGAAACTTACAAGGATTCCCTTAGTAACGGCGAGCGAAC Spirogyra_suncam_ TCTGCCAAAGGAGGAGAGAAGGTGCAAGTTGCATTCAGTGTGGTGAGAAT benazzii GTATGTGGCTGGTTTRGATTATGAYACTCGTTCTTATTTTACTGCAGCTA hepta_italy.freshwater_ GTATGTTGCTGGTTTAGATTATGATACCCGTTCTTATTTTACTGCAGCTA subtentaculata_south GTATGTTGCAGGTTTGGATTATGACACTCGTTCTTATTTTACTGCAGCTA japonica GTATGTTGCTGGTTTAGATTATGATACACGTTCTTATTTTACTGCAGCTA sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella TACGATCTATCCCAAACAAACTTGGGGGTGTCCTAGCACTCTTATTCTCA homo -------------------------------------------------- mexicana CGGGAACAG----------------------------------------- Spirogyra_suncam_ GACTATGGGAGTGAAAAAGGAGAAAGAGCAGGAGAAGGAAAGAATGTTCG benazzii CTATGATTATTGCAGTTCCTACTGGTATTAAGGTTTTTAGTTGAATTGCT hepta_italy.freshwater_ CTATGATTATAGCTGTTCCTACTGGTATTAAGGTTTTTAGTTGAATTGCT subtentaculata_south CTATGATTATTGCTGTTCCTACAGGTATTAAGGCTTTTAGTTGGATTGCT japonica CAATGATTATTGCTGTTCCTACTGGTATTAAGGTTTTTAGTTGAATTGCT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella ATCCTAGTTCTTATGTTAATCCCCCTCCTTCACACCTCAAAACAACGTGG homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ AGGGAGTATGTACAACATGGTTCGAGAGAAA------------------- benazzii ACTCTTTGTGGTACTAGTTTTTTTGATTTAATTG---------------- hepta_italy.freshwater_ ACTCTTTGTGGTACTAGTTTTTTTGATTTAATTA---------------- subtentaculata_south ACTTTATGTGGTACTAGCTTTTTTG------------------------- japonica ACTTTATGTGGTTCTAGCTTTTTAGATTTATGTAGTCGAAGTGTTGTTTT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella AAATGCCTTTCGTCCCCCATCGCAGGCCCTATTCTGAGCCCTAATCTCTA homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica GAATTGATTATTGGGCTTTATTTTTTTGTTTACTGTTGGTGGTTTAACTG sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------GCT---------------------------- dorotocephala_America_ --------------------TTG--------------------------- Scincella ACATCATTATCTTAACATGAATTGGTGGTCAGCCCGTAGAACATCCATTT homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica GTTTAGTTCTTTCTAATGCTAGTTTAGATATTAGTCTTCATGATACTTAT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella ATTATTATTGGCCAAATTGCCTCAACCTCATACTTTATTATTTTTCTTGT homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica TATGTTGTTGCTCATTTTCATTATGTACTTTCAATGGGTGCTGTTTTTAC sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella CCTTATGCCTATAATAGCAAAACTAGAAAACACACTAATAAAATGA---- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica TATTTTTGCTGGTTTTATTCATTGGTGACCTCTTTTTACTGGTTACGTTT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica TAGATCAGTACCTTCTTAAGTTACAGTTTTGGGGTATGTTTATAGGGGTT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica AACATGACTTTTTTTCCTCAGCATTTTTTAGGTCTACAAGGCATGCCTCG sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica TCGAATTTGTGATTATGCTGATGTTTATTCTTTTTGAAAAAGTTTTTCTA sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica GTTTAGGTTCTTTGGTTTCTTTTGTTAGTGTTTTTTTTTTCTTTTATATT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica TTGTATTTAAGCTTTCTTAATTCAGATTCTTTAAAGTTAAGTTCTGTTTT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------------------------------------- hepta_italy.freshwater_ -------------------------------------------------- subtentaculata_south -------------------------------------------------- japonica ATCTAATAGTTCTGAGTGAGCTTATTTTAAGCCTTTAAATTTTCACACAT sicula_Mediterranean_ -------------------------------------------------- aethiopica -------------------------------------------------- notogaea_east -------------------------------------------------- Asteroidea_starfish_ -------------------------------------------------- ours -------------------------------------------------- ryukyuensis_japan_ -------------------------------------------------- dorotocephala_America_ -------------------------------------------------- Scincella -------------------------------------------------- homo -------------------------------------------------- mexicana -------------------------------------------------- Spirogyra_suncam_ -------------------------------------------------- benazzii -------------------- hepta_italy.freshwater_ -------------------- subtentaculata_south -------------------- japonica CTTTGGAGATTCCTTCAGTT sicula_Mediterranean_ -------------------- aethiopica -------------------- notogaea_east -------------------- Asteroidea_starfish_ -------------------- ours -------------------- ryukyuensis_japan_ -------------------- dorotocephala_America_ -------------------- Scincella -------------------- homo -------------------- mexicana -------------------- Spirogyra_suncam_ --------------------
회원작성글 gjhs matin  |  2021.10.23
Q. CCS sequencing의 원리가 궁금해요
요즘 NGS가 신기해서 공부를 하고 있어요.   CCS는 PacBio에서 이용하는 방식이라고 하던데, 영상을 찾아서 보니까   시퀀싱하려는 DNA를 원형으로 만들고 그 DNA를 뱅글뱅글 돌리면서 상보적인 염기를 중합효소로 계속해서 붙여나가더라구요.   그런데 여기서 궁금한 게, 중합효소가 쭉 DNA를 중합하고 있는데 주형가닥이 원형이다 보니 앞에 이미 주형가닥에 결합된 프라이머, 그 이후엔 중합효소 자신이 붙여 놓은 뉴클레오타이드가 있는데 어떤 원리로 밀어내고 계속 쭈우욱 결합을 하는지 궁금합니다.
회원작성글 dlsslgl  |  2021.10.21
Q. 아미노산과 뉴클레오타이드 뒤의 번호는 고유번호인가요?
https://www.microbiologyresearch.org/content/journal/ijsem/10.1099/ijs.0.02443-0;jsessionid=awrPw0HdWD5-XHaoZ5Yu36Ux.mbslive-10-240-10-180 어떤 세균의 속에 대해 자이레이스 유전자로 유전적 계통을 분석한 논문을 읽고 있습니다. 저는 생명공학 전공자는 아닙니다. 혹여나 너무 기초적인 질문이진 않을까 싶은데, 여기서 289aa와 869bp는 아미노산과 뉴클레오타이드의 종류 중 하나인가요? 이것이 고유한 번호인지 궁금합니다. amino acid 289aa라고 검색해 봤을 때는 이것이 어디에 속하는 것인지 잘 모르겠습니다. aa가 amino acid의 약자인 것인지, 아니면 이 아미노산을 생성하는 뉴클레오타이드가 아데닌 두 개라는 것인지 모르겠습니다. 1. 여기서 289aa와 869bp라는 숫자들을 뭐라고 부르나요? 2. 이 숫자들은 해당 종들의 동정에만 사용되는 번호인가요? 3. 만약 이것이 번호라면 1부터 시작하는 아미노산과 뉴클레오타이드도 있나요?
회원작성글 C. hastatu..  |  2021.10.21
Q. Base Calling의 뜻이 뭔가요?
DNA 시퀀싱에 있어 Base Calling의 의미가 무엇인지 궁금합니다.   분석과정에서의 염기를 실제 염기로 바꾸는 과정이라는데, 이게 도무지 무슨 말인지 이해가 안됩니다..
회원작성글 dlsslgl  |  2021.10.20
Q. NGS 용어와 정보에 대해 고수님들의 눈높이 설명이 필요합니다...
제가 교수님 따라 거의 짐꾼 느낌으로 학회에 갔을 때에, 다른 교수님들과의 대화를 들은 내용 중 언뜻 기억이 나서 수첩에 적어둔 게 있습니다. 그런데 이 말들이 "DNA"처럼 한가지 뜻으로만 쓰이는 말이 아니라 너무 많은 검색 결과가 나오고, 가끔 제대로 찾긴 해도 정의가 너무 어려운 단어로 적혀있어서 제가 원하는 "NGS 분야에서 실무자들이 정확하게 어떤 의미로 쓰는지" 알기가 어렵더군요... 그래서 죄송스럽지만 어른이 아이에게 알려주듯이 쉬운 말로 설명해주시면 감사하겠습니다. 수동적인 태도가 맘에 들지 않으실 수 있겠지만 부탁드립니다.   1. 컷오프. 영어로는 cut off로 표기하는 것 같습니다. 2. Coverage. 3. Depth. 이 용어는 상대 교수님이 저희 교수님한테 설명하시는 걸 들었는데 이해를 못했습니다... 4. Cycle. "300사이클, 600사이클로 돌렸다"는 식으로 얘기하던 걸 들은 적이 있습니다. 5. Mapping. 이 용어는 시퀀싱해서 나온 데이터를 레퍼런스 시퀀스에 얼라인먼트한다는 뜻으로 이해했는데 맞나요? MEGA 프로그램으로 시퀀스 비교하듯이요. 6. Read. 몇리드 몇리드 하시던데 리드가 얼마가 나와야 하나요? 7. Read Length. NGS 라이브러리는 DNA를 원하는 사이즈로 잘라서 풀링함으로써 만드는 것으로 알고 있는데, 그 사이즈와 실제 시퀀싱 결과 Length가 다른가요? 그리고 그걸 비교하려고 만든 용어인가요? 8. 한 회사의 제품 중에도 여러 가지 시퀀싱 장비가 있던데, 시퀀싱 주문에 따라 장비를 선택하는 기준이 있나요? 9. 16S, TruSeq, illumina DNA 등 여러 프렙 키트가 있던데, 키트를 선택하는 기준이 있나요? 10. 7번과 같이 WGS, 16S Metagenome, Shotgun, Nanopore 등 많은 시퀀싱 방법이 있던데, 이 방법들을 선택하는 기준도 있나요? 11. 시퀀싱에서 GC 컨텐츠가 너무 높으면 Qscore가 낮아진다고 하던데, 어딜 가나 AT컨텐츠는 없고 GC 컨텐츠를 기준으로 삼는 이유와 Qscore가 낮아지는 이유가 궁금합니다. 12. 숏리드? short read는 contig의 수를 보장하지 못한다고 들었는데 이 말은 반대로 long read는 contig 수를 보장할 수 있다는 말인지. 그리고 contig 수를 보장한다는 말은 contig가 많이 나온다는 뜻인지, 얼마나 나올지 예측할 수 있다는 뜻인지. 그리고 contig가 많이 나와야 좋은 것인지 궁금합니다.   질문이 너무 많네요..! 시간이 없다면 지나가는 길에 이들 중 한 개만이라도 스르륵 답변해주시면 정말 감사하겠습니다 ㅠ
회원작성글 dlsslgl  |  2021.10.18
Q. victor 프로그램 안되는 이유
genome file에 fasta file 넣었는데 이런식으로 계속 나옵니다. 이름 설정을 바꾸기 전 파일은 잘 됩니다... 파일의 이름 설정은 '이름 (no.)'로 했습니다 안되는 이유가 뭘까요ㅜㅠ  
회원작성글 wodls  |  2021.10.11
Q. sequencing 관련해서 수정해서 문의드립니다. 첨부파일
안녕하세요. 미생물 sequencing (16rDNA) 관련해서 질문이 있어서 글올립니다. 최근 어떤 균주에 대해서 Universal primer 인 27F, 533F, 907R, 1492R 을 이용해 다음과 같이 정해진 위치에서 sequence를 읽게 되었습니다. 그런데 교수님 말씀으로는 정확한 염기서열을 읽기 위해서는 지금 읽은 부위를 토대로 다른 특정 primer 를 디자인 한 뒤, 온전히 1.5kb 정도의 sequence를  읽어야 한다고 말씀해 주셨습니다. (보시는 바와 같이 각각의 primer 가 읽은 부분이 짧거나 공백이 있는 부분이 존재합니다.)  그렇다면, 지금 읽은 sequence를 토대로 정확히 어느 위치에서 프라이머를 제작해야 되고, 제작을 하게 된다면, 지금 universal primer 로 읽은 sequence를 토대로 어떻게 prmer를 제작해야되는지 잘 몰라서 글을 남기게 되었습니다. 방법을 아시는 분들의 답변 기다리겠습니다.   
회원작성글 Icomet1994  |  2021.10.07
Q. sequencing 관련해서 문의드립니다. 첨부파일
안녕하세요. 미생물 sequencing (16rDNA) 관련해서 질문이 있어서 글올립니다. 최근 어떤 균주에 대해서 Universal primer 인 27F, 533F, 907R, 1492R 을 이용해 다음과 같이 정해진 위치에서 sequence를 읽게 되었습니다. 그런데 교수님 말씀으로는 정확한 염기서열을 읽기위해서는 지금 읽은 부위를 토대로 다른 특정 primer 를 디자인 한 뒤, 온전히 1.5kb 정도의 sequence를  읽어야 한다고 말씀해 주셨습니다. 그렇다면, 지금 읽은 sequence를 토대로 정확히 어느 위치에서 프라이머를 제작해야 되고, 제작을 하게 된다면, 지금 universal primer 로 읽은 sequence를 토대로 어떻게 prmer를 제작해야되는지 잘 몰라서 글을 남기게 되었습니다. 방법을 아시는 분들의 답변 기다리겠습니다.      
회원작성글 Icomet1994  |  2021.10.07
Q. flanking sequence를 이용해 T-DNA insertion의 정확한 위치를 어떻게 알 수 있나요?
T-DNA insertion 위치를 확인하는 방법을 알아보고 있는데, 기초지식이 부족하다보니 T-DNA insertion과 flanking sequence의 관계가 헷갈린 상태입니다. 제가 알기론 flanking sequence가 T-DNA insertion으로 인해 끊기기 전까지의 sequence인걸로 알고 있는데, 문제는 이렇게 끊긴 sequence의 좌측(시작점)과 우측(종결점) 중 어디에 T-DNA insertion이 들어간건지를 모르겠습니다.    아마, orientation이 forword인지 reverse인지에 따라 좌측(시작점) 또는 우측(종결점)에 T-DNA insertion이 됬는지, 결정되는거 같은데 제가 제대로 이해하고있는건지 모르겠습니다.
회원작성글 대학원생1입니다  |  2021.10.06
Q. transcription factor binding motif enrichment assay 피규어해석..... 첨부파일
안녕하세요 선생님분들.. 저는 암생물학을 전공으로 하는 석사 1기 대학원생입니다.. 다름이 아니오라 제가 논문공부를 하는데 위의 피규어가 의미하는 바를 잘 이해하지 못하겠습니다. 형형색색의 알파벳들이 sequence logo로 특정 염기들의 빈도라는 것은 알겠지만 이것이 TF motif enrichment와 어떻게 관계가 있는것인지 전혀 감이 안오네요.. 논문에 붙어있는 figure 설명과 method and material 부분에도 자세히 설명되어있지 않아서요.. 구글과 유투브를 싹 다 뒤져봐도 잘 모르겠읍니다.. 어쩌면 감히 제가 이해하려하는 것부터 잘못된 걸까요... 선배님들의 고견, 감히 여쭙겠습니다..!!  
회원작성글 사슴풍뎅이  |  2021.09.30
Q. gel extraction 후 sequencing이 잘 되지 않는 이유가 뭘까요ㅠㅠ 첨부파일
안녕하세요. 도저히 잘 풀리지않아 여쭤봅니다ㅠㅠ   유산균의 plasmid의 서열을 읽으려고 하는데요ㅠ plasmid prep한 후 1% agarose에 전기영동하여 gel extraction 하였습니다. 그런데 gel extraction 후 전기영동으로 확인하고 sequencing을 보내면 결과가 좋지 않습니다ㅠㅠ (전체적으로 multi peak이 보입니다...)   size는 5kb 전후로 예상하고 제한효소로 cutting되는 것을 확인하여 그 제한효소로부터 primer를 제작하여 sequencing 하였습니다   기존에 column type의 kit를 사용할 때는 수율이 너무 낮았고 bead type의 kit을 쓰니 band는 보이는데 sequencing이 되지 않으니 너무 답답합니다ㅠㅠ   gel extraction sample의 전기영동 사진을 첨부합니다ㅠㅠ 도움 주시면 감사드리겠습니다!!
회원작성글 ㅇㅋㅇㅋ  |  2021.09.30
Q. mega 사용시
 mega를 이용하여 계통분석을 하려고 하는데요. 식물의 trn L-F지역의 서열인데 자꾸 이런 오류가 뜨는데 원인이 무엇일까요? 총 79개 인데 너무 많아서 그런가요? 답변 주시면 감사하겠습니다.   
회원작성글 솔잎  |  2021.09.24
Q. MEGA X를 이용한 phylogenetic tree 질문이 있습니다
  곤충의 COI을 이용하여 phylogenetic tree를 그리려고 합니다   알고리즘은 K2P를 이용하였고 Maximum Likelihood method로 tree를 그렸습니다(original tree입니다)   ML은 default로 두었는데 NJ/BioNJ였던 것으로 기억합니다 bootstrap test는 1000회 입니다   sample은 총 6개이며 그 중 1,2,4,6이 제가 사용하려는 sample이고 나머지 6개는 다른 논문에 실린 sequence를 얻어왔습니다   mega alignment할 때 보시는 것 처럼 gap이 너무 커서 빨간 선처럼 모두 일치하는 서열 부분만 잘라서 사용한게 맨 위 tree입니다     여기까지 사전 정보이고요   제가 궁금한 것은,   제 sample과 비교할 종은 2종입니다. A(no. 5), B(no 3, 7)이라고 합시다   1번은  blast 결과 A에 대해서 per. ident 100% query cover 100%  B(no.3)에 대해서 per. ident 99.84% query cover 100%, no.7에 대해서는 95.3%, 100% 2번은 A에 대해서 per. ident 100% query cover 83%, B(no.3)에 대해서 per. ident 99.84% query cover 83%, no.7에 대해서는 94.96%, 95%가 나옵니다 4번은 A에 대해서 per. ident 100% query cover 84%  B(no.3)에 대해서 per. ident 99.84% query cover 84%, no.7에 대해서는 95.25%, 97% 6번은 A에는 99.84%, 85%이고 no.3 B에는 99.67%, 85%이고 no.7에는 95.11%, 98%입니다   A는 ncbi에 등록된 sequence가 이것밖에 없고 B는 조금 더 있지만 비교를 위해 2가지만 가져왔습니다   분류는 형태분류를 우선시 하는게 맞지만 애매한 점이 있어서 분자동정으로 넘어오게 되었는데요   이런 경우에 저의 sample 4개와 A, B종은 서로 같은 종이라고 볼 수 있을까요?   tree를 그리는 데 사용하지 않았지만 B종의 경우 per. ident가 94%~92%인  sequence도 존재해서 이렇게 큰 차이를 보여도 서로 같은 종으로 보아야 하는지 난감해서 질문을 올려봅니다    
회원작성글 도토리묵  |  2021.09.13
Q. receptor 찾기
안녕하세요 지금 석사 2기 막 접어든 대학원생입니다. 지금 DR5,DR4에 대해서 배우고 있는데 DR5,와 DR4 receptor를 가지고 있는 세포?를 찾아야하는데 어떻게 찾는지 아시는 분 있으면 답변 부탁드립니다 ..ㅠㅠ
회원작성글 졸업반+새내기  |  2021.09.02
Q. qPCR을 이용한 DNA sequencing
sequencing을 진행하려고 하는데 qPCR을 이용하여 sequencing을 할수 있다는 얘기를 들었는데 가능한 방법인가요?? 혹시 해보시거나 아시는 분 계시면 답변부탁드립니다!
회원작성글 Vind  |  2021.08.30
Q. PCR product를 sequencing 맡길 때..
main band 윗 쪽에 옅게 잡밴드가 뜨긴 했는데,   이 상태에서 sequencing을 맡겨도 결과 받는데 이상 없을까요?   아니면 gel extraction을 하고서 보내야하나요?
회원작성글 간첩신고113  |  2021.08.24
이전  01 02 03 4 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
써모피셔사이언티픽 광고