[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
써모피셔사이언티픽
배너광고안내
이전
다음
스폰서배너광고 안내  배너1 배너2 배너3 배너4
BioLab 박소정 교수
전체보기 안전점검 LABox
 카테고리: 전체 > Microbiology > Bacteria
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. 급합니다. Dmso 오토클레이브 돌려도 괜찮나요?ㅠㅠ
안녕하세요 추출물의 열 안정성 실험을 하려고 합니다 추출물의 고형분을 녹이는 용매가 DMSO입니다 찾아보니 끓는점이 121도 보다 높아 사용하는건 문제가 없을거같은데 인화성이라 걱정이네요 열에도 안정한지를 봐야해서 121도에 처리가 필요합니다 오토클레이브 사용 가능할까요? 다른 실험으로도 사고가 최근에 나서 겁이나네요 주위에 아무도 돌려본 사람이 없다고 합니다 ㅠ
회원작성글 이이이여  |  10.25
Q. real time pcr
Standard curve 를 그리기 위해 DNA serial dillution 후에 real-time pcr를 이용하였습니다.. standard curve는 0.996 이 나왔는데,, melting curve가 이상합니다... 그리고 curve 효율도 조금 낮은것같구요..  forward primer : GGGCCGAATTTGGATACATT 45% GC, 54 ℃ Backward primer : ATCCGCCCCCATATTTAAAG 45% GC,  53 ℃ 95℃ 10min / 35℃ 30s, 50℃ 1min/ 72 1min, 72 10min / 40cycle 다음과같은 조건으로 qpcr를 시행하였습니다.   어떤 조건을 수정해야지 curve효율이나 melting curve가 이쁘게 나올까요?ㅜㅠ 감사합니다. :)  
회원작성글 미생물킬러  |  10.21
Q. S. Mutans 균 구하는 방법이 궁금합니다.
S. Mutans균 배양 실험을 하려고 하는데 S. Mutans균은 어떻게 구할 수 있나요?
회원작성글 flauvel  |  10.19
Q. 초록색으로 발색하는 균도 있나요? 첨부파일
문 손잡이에서 채취해서 배양한 건데, 배지 전체가 초록색으로 변한걸 발견했어요. 어떤 작용이 일어난건지 궁금합니다!! 위에 뭉텅이로 자란 균을 떠서 빛에 비춰봤는데 연한 초록색으로 보였어요. 배지 옆부분을 보면 딱 봐도 밑까지 선명한 초록색으로 변해있는데, 어떤 균이나 어떤 미생물이 이런 역할을 할 수 있는건가요?? 채취한 시료를 여러번 다른 배지에 배양했었는데, 매번 배지 색이 통으로 바뀌었어요.
회원작성글 아기물화생  |  10.19
Q. 천연 유래 항생물질과 세균에 관해..
항생제 감수성에 관한 실험을 하며 천연유래 항생 물질에 관해서도 함께 탐구하려고 합니다. 이때 천연유래 항생 물질이 세균에 어떤 영향을 주는 지 고등학생이 알 수 있는 방법 없을까요..?
회원작성글 우하  |  10.19
Q. 대장균을 대체할 수 있는 다른 세균이 절실합니다
안녕하세요 실험동아리를 이끌고 있는 한 학생입니다! 실험중 배양한 박테리오파지가 제 역할을 하는지 확인하는 과정이 필요했고, 이를 위해 대장균을 배양하고 그 위에 박테리오파지를 몇방울 떨어뜨려 용균반을 확인해보고자 했는데요 갑자기 교육청이 대장균 배양을 일방적으로 금지해버렸습니다 ㅠㅠ 꼭 진행하고 싶은 실험입니다. 정말 절실합니다. 1) 박테리오 파지가 표적으로 삼는, 2) 후진(?) 학교 실험실에서 배양할수 있는 다른 세균이 존재할까요? 제발 부탁드립니다.
회원작성글 cosx  |  10.15
Q. Blue-White screening시 White colony만 나왔다면 어떤 게 문제인건가요?
Blue-White screening을 수행했는데, blue colony는 아예 보이지 않고, white colony만 나왔습니다. Blue colony가 조금이라도 있어야 할 것 같은데, 실험 과정 중에 무엇이 문제였는지 모르겠습니다. TA cloning할 때 RBC사의 kit를 사용해서 insert DNA를 ligation시켰고, plasmid vector에는 Amp r, LacZ알파, MCS, ori site가 있습니다. Bacteria는 Top10 competent cell을 이용하였으며, LB plate에는 Amp과 X gal을 도말해주었습니다.
회원작성글 꿀고구마맛탕  |  10.12
Q. 발효조 Scale-up
플라스크에서 퍼멘터로 스케일업을 진행 할 때 탄소원의 농도를 다시 최적화를 하는데 어떤 이유가 있을까요 ?? 아시는 분 답 부탁드립니다 ㅠㅠ
회원작성글 으리으링  |  10.11
Q. Blue-White screening시 White colony만 나왔다면 어떤 게 문제인건가요?
Blue-White screening을 수행했는데, blue colony는 아예 보이지 않고, white colony만 나왔습니다. Blue colony가 조금이라도 있어야 할 것 같은데, 실험 과정 중에 무엇이 문제였는지 모르겠습니다.
회원작성글 꿀고구마맛탕  |  10.11
Q. 유산균 액체 배지 배양
유산균이 mrs배지말고 pc액체 배지에서도 자라나요?
회원작성글 생과공부  |  10.09
Q. 유산균 배양 대행 업체가 있을까요?
유산균을 사용해서 실험을 계획중인데, 혹시 배양 및 heat kill 후 동결건조까지 대행해주는 업체가 있는지 궁금합니다.    
회원작성글 아이고야  |  10.06
Q. 세균 100배율 관찰 분석 첨부파일
안녕하세요!!!!! 이 사진에서 보이는 것과 엥 싶은 것들을 찾아주세요!!! 아는게 너무 부족해서 세균 분리하고 열심히 키우고 염색도 해줬는데 ㅠㅠ 뭐가뭔지 모르겠어요 염색은 세포에 색깔만 입혀보고싶어서 베양액 70ul굽고 사프라닌오로 1분 염색했어요. 세균이 깔려있고 세포가 몇개 있는 모습일까요 아니면 깔린건 그냥 염색약이랑 액체고 위에 덩어리진 애들이 세균일까요???? 100배율입니다!
회원작성글 아기물화생  |  10.05
Q. 셀 카운팅 시 챔버에 보이는 첨부파일
400배율로 셀카운팅 챔버 (1회용이요!!)관찰하다가 요리조리 돌리다보니 저런 모습이 보이더라고요!! 제가 고등학생이라 세균이나 세포가 어떤 모습으로 보이는지에 대한 경험이 부족해서 그런데, 저 사진 속 모습은 각각 파란색이 트리판블루로 염색된 세균인가요?? 잘 보면 작고 투명한 원들이 모여있는 것 처럼 보이는데, 그게 세균인가요? 셀카운팅은 일반세균 배양해서 썼는데, 아마 한 종류 균만 분리하진 못한 것 같았어요. 전공자분들 또 세균관찰에 익숙하신분들 도움이 필요합니다 ㅠㅠ!!
회원작성글 아기물화생  |  10.05
Q. 고체배지 이용 내성세균 관찰
저는 현재 고등학교 2학년 학생이고 일상생활 속의 항균물질들에 의한 내성세균 진화 관찰 이라는 실험을 계획하고 있습니다. 대략적인 과정은 다음과 같습니다.  배양기로 배지에 세균(대장균, 포도상구균)을 배양시킨다. 세균 콜로니들을 체취하여 한천 배지 4개에 하나씩 올려놓고 상태를 관찰, 기록한다. 락스, 손소독제, 비누, 마늘즙을 증류수를 이용하여 희석한다. 배지 위 콜로니에 락스, 에탄올, 비누, 마늘즙의 농도를 0%에서 적당히 올려가며 희석액을 각각 떨어뜨리고 각 희석액마다 콜로니가 유의미하게 사라지는 항균물질 희석액의 농도를 구한다. 콜로니에 각 희석액을 낮은 농도부터 떨어뜨리고 살아남은 세균들을 새 한천 배지에 옮겨(어떻게??) 배양시켜서 생긴 콜로니에 더 높은 농도의 희석액을 떨어뜨리고 처음 콜로니가 사라지는 농도에 도달할 때까지 같은 과정을 반복한다. 종류별로 처음에 콜로니가 사멸된 정도와 같은 농도에서 진화된 콜로니가 얼마나 사멸되는지를 비교한다. 그런데 희석액을 떨어뜨린 후 살아남은 세균들을 어떻게 체취하고 배양시켜야 할지 방법을 잘 모르겠습니다. 혹시 좋은 방법을 아신다면 알려주시거나 제 실험 설계에 문제점이 있다면 지적해주시면 감사하겠습니다. 
회원작성글 khg257979  |  10.03
Q. 알파 용혈 베타 용혈
배양하고 담날 아침 녹색으로 알파 용혈이 생겼는데 일주일쯤 지나니까 투명하게 변해서 베타 용혈인가 싶기도 하고 어떤 세균인지는 모릅니다  이거는 알파용혈균으로 봐야하나요?
회원작성글 Thkffk  |  09.30
Q. 혐기성 세균 injection 실험
혐기균 다뤄보신 분들께 질문이 있습니다. 혐기균을 마우스에 treat할 때 어떤 방법을 사용하시는지 궁금합니다. 죽어있는 균 말고 살아있는 균을 마우스에 injection 시키고 싶은데, 방법이 따로 있는지 여쭤봅니다!
회원작성글 kkykk  |  09.28
Q. 동물행동실험 트레드밀 대여
안녕하세요  동물행동실험을 통해서 약효 평가를 하고자 하는데요  혹시 몇개월정도  동물행동실험에 필요한 트레드밀 기계를 대여할 수 있는 곳이 있을까요?  대부분 테크노파크와 같은 곳은 저희가 동물을 데려가서 실험을 하는 곳인데  기계 자체를 대여할 수 있는 곳이 있을까요?   
회원작성글 필로겔로스  |  09.27
Q. 분리한 미생물 사용가능 여부 첨부파일
미생물 고수님들 도와주세요.. 미생물 분리해서 Latilactobacillus Curvatus와 Weissella minor를 분리 동정하였습니다. (16S rRNA) 둘 다 유산균이고 해당 균주로 발효 진행하려고 하는데  KCTC같은 생물자원센터에서 분양받은 균주가 아니고 직접 분리한 거라서 제품에 사용 불가능한지 궁금합니다,,  
회원작성글 인사이드  |  09.27
Q. 식품의 밀봉 여부 확인 방법
안녕하세요 혹시 식품의 밀봉 여부를 확인할 수 있는 방법이 있을까요? 식품공전을 보면 밀봉은 40)‘밀봉’이라 함은 용기 또는 포장 내외부의 공기유통을 막는 것을 말한다.라고 되어있던데 조금 애매한것 같아서요 ! 밀봉 여부를 확인하는 방법이 있을까 해서 문의드립니다~
회원작성글 지민쨩  |  09.26
Q. gram-staining을 했는데 양성인지 음성인지 잘 모르겠네요 첨부파일
도말을 할때 좀 더 신경을 썼어야했는데 처음이라 잘 못했네요.. gram-staining을 했는데 양성인지 음성인지 잘 모르겠습니다. 보라색 같기도 한데 살짝 붉은기도 도는것 같고 모르겠네요.
회원작성글 빈가루  |  09.26
이전  01 02 3 04 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
위로가기
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
필코리아테크놀로지 광고