[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
스폰서배너광고 안내  배너1 배너2 배너3 배너4
BioWave  Vol.25, No.2 (2023년 2월) 오픈
전체보기 안전점검 LABox
 카테고리: 전체 > Molecular Biology-RNA > Small RNA Analysis
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
 Melan a cell 조직에서 Trizol을 사용하여 RNA를 추출하였습니다. 조직 lysis 후 , Trizol에 chloroform을 넣어 vortexing하여 섞은 후, 몇 분 방치 한후 13000rpm 에서 10분간 centrifuge하였습니다. 4도씨에 1-3 시간 보관하고 (70% 에탄올로 washing 13000rpm 에서 10분간 centrifuge 3 번 하였습니다). 5분 건조하고 0.1% DEPC 20 μl 넣었습니다  RNA를 측정하였을때 A260/A280은 1.9정도 나오는데,  A260/A230은 2.3정도 나옵니다 ㅠㅠ.  cDNA 합성해도 될까요? A260/A280 과 A260/A230 값이 얼마정도 좋아요?  어떻게 해야 해결될지 고수님들 의견 부탁드립니다 ㅠㅠ
회원작성글 karan  |  01.26
Q. pre-miRNA primer design
이번에 precursor miRNA를 qPCR 하기 위해 primer를 design 하게 되었는데요 miRNA qPCR용 primer design을 할 수 있는 프로그램이 뭔가 많아보이는데 유료인 것 같기도 하고 제가 잘 다룰 줄을 몰라서 직접 디자인하였습니다. 일단 일반 PCR 하듯 design했는데 다른 사이트에서 보니 SYBR green prove를 고려해서 design 해야한다는 말을 본 것 같아서 잘 만든게 맞는지 모르겠습니다. precursor miR seq 5’TGCTTCCCGAGGCCACATGCTTCTTTATATCCCCATATGGATTACTTTGCTATGGAATGTAAGGAAGTGTGTGGTTTCGGCAAGTG3’  3’ACGAAGGGCTCCGGTGTACGAAGAAATATAGGGGTATACCTAATGAAACGATACCTTACATTCCTTCACACACCAAAGCCGTTCAC5’(빨간 부분은 mature mir seq이라서 primer 겹치면 안돼요!) F: GCTTCTTTATATCCCCATATGG (22nt, TM 52, GC% 41) R: GCAAAGTAATCCATATGGGGATA (23nt, TM 54, GC% 40)
회원작성글 별헤는밥  |  01.10
Q. small RNA primer 디자인
small RNA 를 타겟으로해서 정량을 해야해서 primer를 디자인하려는데 주로 사용하던 프라이머 디자인 프로그램을 사용하려니 서열이 짧다고 안되네요ㅠㅠ smallRNA primer를 제작하고자 하는데 어떤 프로그램이 있을까요..?
회원작성글 별헤는밥  |  01.03
Q. miRNA primer
precursor miRNA를 qPCR하려고 NCBI에서 시퀀스 서열을 확인한 뒤 프라이머를 만들었습니다. 근데 궁금한 점은 mature miRNA가 precursor miRNA에서 만들어지는데 precursor miRNA의 3',5'의 프라이머가 mature miRNA에 붙어서 인식될 경우는 없는 걸까요? 그리고 다른 질문들 보니까 precursor miRNA가 primary miRNA에 붙을 가능성에 대해 걱정하시던데 small RNA isolation kit를 이용하면 200nt 보다 작은 rna만 추출되니까 이 부분은 걱정 안해도 될까요? 이 쪽 분야를 이제 막 시작하게 되어서 공부중인데 precursor miRNA에 관해선 정보가 많이 없어서 브릭에서 활발히 지식 나눔해주시는 선배님들께 자문을 구합니다ㅠㅠ
회원작성글 별헤는밥  |  2022.12.28
Q. total rna 추출
total rna 추출 실험을 하였는데요. 프로판올을 넣고 10분간 기다렸다가 원심분리 10분한 다음에 작은 양의 rna가 침전되었는지 확인을 해야 되는데 육안에 전혀 보이지 않더라구요. 그래서 일단 에탄올 넣고 다시 4도 원심분리기에서 5분간 원심분리하니 그때 rna가 보이더라구요. 왜 에탄올 넣고 원심분리 하니까 보이게 된 걸까요??
회원작성글 시모나  |  2022.12.12
Q. siRNA knockdown
안녕하세요. 실험실에서 G-fectin을 이용하여 특정 gene을 녹다운 하고 있습니다.  lipofectamine 대신에 사용하고 있는데  24시간 동안 G-fectin과 siRNA를 처리하고 그 후에 약물을 처리하고 있습니다. 약물을 처리할려고 24시간 전에 처리했던 g-fectin이 포함된 배지를 suction하고 새로운  media로 체인지하고 약물을 처리하는데  혹시 새로운 media change 하기 전에 PBS 워싱을 꼭 해야하나요...? 
회원작성글 카스테랑  |  2022.11.10
Q. miRNA의 control을 찾으려면...
miRNA 의 발현을 보려고 하는데 miRNA가 잘 발현되는 positive control 조직 부위를 알고 싶습니다. 구글링이나 논문을 찾아봐도 잘나오지않는데 혹시 관련 사이트라던가 찾는 방법을 아시는 분이 계실까요? 
회원작성글 hazzy  |  2022.11.01
Q. siRNA electrophoresis 실험이 잘 안되네요ㅠ
안녕하세요. 저는 polymer base의 nanoparticle을 이용해 siRNA를 delivery하는 실험을 진행중인데요. 이들이 complex를 잘 형성했는지 보기위에 electrophoresis 실험을 현재 하고 있는데 결과가 너무 안나오네요. 저는 현재 Bioneer에서 negative control로 판매하는 FITC labeled siRNA를 이용하고 있으며, agarose gel은 1.5%~3% 모두 해보았습니다. buffer는 TAE buffer를 이용하고 있으며 gel dye로는 eco dye를 이용하고, gel 60ml 기준 eco dye 40ul을 사용합니다. well 하나 당 5ul의 sample을 loading하는데, siRNA는 280ng(10uM 기준 2ul)+loading buffer 2ul + DEPC 1ul을 mix하여 사용합니다. 논문을 따라서 100V에서 20~40min 내려보았는데, ladder는 보이는데 siRNA는 전혀 보이지 않아요... 무엇이 문제일까요?ㅠ 도와주세요..! ㅠㅠ
회원작성글 덜덜루밍  |  2022.10.25
Q. 바이오마커 타켓으로서의 pre-miRNA
miRNA를 바이오마커로 사용하는 실험을 계획중인데 어떤 논문에서는 miRNA의 전 단계인 pre-miRNA(miRNA precursor)를 유방암 바이오마커 타겟으로 설정하고 찾아낸 논문이 있었습니다. pre-miRNA를 바이오마커로 사용해도 되는건가요..?
회원작성글 별헤는밥  |  2022.10.10
Q. gapdh 와 알파 튜뷸린 첨부파일
안녕하세요 gapdh와 알파튜뷸린두개 모두 house keeping gene이라는건 알고있습니다. 그림에서는 gapdh을 사용했는데 바로 다음 결과는 (사진을 하나밖에 못올려서... 글로 설명드리겠습니다.) si ampk와 rg2처리 모두 같고 bcl-2,bak, parp, cleaved parp 발현양을 측정한 결과지입니다만. 여기서는 house keeping gene으로 알파 튜뷸린을 사용했습니다 ㅜㅜ  질문: 두 실험이 비슷한실험같은데 왜 house keeping gene을 통일하지 않고 (사진은 gapdh) 다음실험은 알파튜뷸린을 사용하였나요?? 감사합니다.
회원작성글 까오낫  |  2022.09.29
Q. 특정 miRNA 농도를 확인하는 방법이 궁금합니다.
안녕하세요, miRNA에 대한 연구를 진행하고자 하는 석사과정중인 학생입니다. 현재 miRNA를 이용한 biosensor에 대한 연구를 하려고 하는데, biosensor를 할 때 miRNA를 농도별로 확인을 하는 과정이 있었습니다. 그래서 miRNA의 농도를 어떻게 구하는지 궁금해져서 논문들을 확인해보았는데, total miRNA의 농도를 확인할 때 이용한 kit들은 많이 소개를 해주고 있지만 특정 miRNA의 농도를 구하는 법은 딱히 언급해주지 않더라고요..! 그래도 표준 물질 첨가법을 이용하여 농도를 확인할 수 있다는 것을 확인했는데, 이를 제외하고 어떤 방법이 있는지 궁금해서 글을 남기게 되었습니다. 감사합니다!
회원작성글 바안지  |  2022.09.08
Q. miRNA inhibitor 제작
miRNA inhibitor를 회사에서 파는게 있고 논문을 읽다보니 주문해서 제작한 방법이 있던데요 회사에서 파는 inhibitor는 제가 억제할 miRNA sequence에 specific 한 sequence로 miRNA inhibitor를 파는 반면에  논문에서 주로 많이 사용하는 miRNA inhibitor sequence는 miRNA sequence와 중간 중간 서열이 다릅니다.    siRNA와 달리 miRNA 억제할 때는 sequence와 맞지 않아도 억제가 잘 되는 건가요?
회원작성글 dreamjw021..  |  2022.06.10
Q. hTERT를 siRNA로 처리하여 암의 텔로머레이스 활성을 억제할 때 암 세포만 표적할 방법이 뭐가 있을까요.
hTERT를 siRNA를 통해 활성을 억제하여 암을 치료하기 위해 drug로써 사용하기 위해서 투여하면 암세포 말고 줄기세포등의 다른세포들도 텔로머레이스 활성이 억제되지 않을까하는 생각이 들어 질문드립니다. 
회원작성글 jay9831  |  2022.05.25
Q. 암을 텔로머레이스를 siRNA로 처리하는 방식으로의 치료가 가능할까요?
많은 종류의 암이 텔로머레이스의 비정상적인 활성으로 인해 무한히 증식으로 생겨나는데 그럼 텔로머레이스가 제 역할을 할 수 없도록 siRNA로 처리하는 방식으로 암을 치료하는 것이가능할까요?
회원작성글 jay9831  |  2022.05.23
Q. TaqMan® MicroRNA Assays 제품에 대해서
TaqMan 실험을 처음해봅니다...! TaqMan® MicroRNA Assays 제품만 구매하면 cDNA 합성하고 qPCR도 할 수 있는건가요?
회원작성글 hhhhhhhha  |  2022.04.21
Q. miRNA와 관련해 질문있습니다
miRNA에 대해 공부하고있는데 궁금한 사항이 있어 글남겨봅니다   miRNA가 mRNA와 관련이 있다는것은 알겠는데 miRNA가 어떤 RNA에게 영향을 미치면 그 miRNA 의 -3p나 -5p도 같은 영향을 미친다고 봐도 되는지 궁금합니다.   예를들어 miR-1 이 특정 A라는 유전자의 발현과 관련이 있으면 miR-1-3p나 miR-1-5p도 A의 유전자 발현에 영향을 미치나요?   아무리 찾아봐도 잘 모르겠어서 혹시 참고할 자료라도 알려주신다면  열심히 공부하겠습니다   감사합니다.
회원작성글 진도하  |  2022.03.23
Q. siRNA Santa transfection이 잘 안됩니다. 도움을 요청드립니다 (Protocol첨부) 첨부파일
안녕하세요. 최근 siRNA실험을 진행하고 있는 대학원생입니다.   siRNA 프로토콜을 열심히 숙지하고, siRNA에 대해서 공부하면서 처음으로 siRNA실험을 진행하고 있습니다만, Transfection이 잘 안되고 있습니다.   실험 초반, Gene Down이 된 것을 확인하고, 이 후 실험에서는 계속 Gene Down이 잘 되지않아 처음에는 siRNA의 실험을 자주하면서 활성도가 떨어졌을거라 가정도 했지만 제 실험방법에 문제가 있을 것 같다고도 생각하면서 브릭에 계신 연구원 선생님들의 지혜를 꼭 구하고 싶어서 이렇게 글을 씁니다. 내용이 길고 복잡하더라도, 도움주시면 저도 꼭 훌륭한 연구자가 돼서 많은 도움을 줄 수 있는 선배 연구자가 되겠습니다.   제가 사용하는 siRNA Protocol 입니다.  siRNA Protocol내용 중 1.Prepare the following solutions: Solution A: For each transfection, dilute 2-8 µl of siRNA duplex (i.e. 0.25-1 µg or 20-80 pmols siRNA) into 100 µl siRNA Transfection Medium: sc-36868. 항목을 수행하기 위해   Target Gene에 대한 siRNA 시약(siRNA duplex)을 구매했고, Data sheet에 나와있는 Resuspension을 참고하여 [Resuspend lyophilized siRNA duplex in 330 µl of the RNAse-free water provided. Resuspension of the siRNA duplex in 330 µl of RNAse-free water makes a 10 µM solution in a 10 µM Tris-HCl, pH 8.0, 20 mM NaCl, 1 mM EDTA buffered solution] <- (Target siRNA Data sheet내용) 설명서대로 구매한 Target siRNA 파우더에 함께 제공된 RNAse-free water 330 µl를 넣었습니다. 그 후, siRNA Protocol을 참고하여 위에서 만든, siRNA duplex 8 µl를 따서 siRNA Transfection Medium: sc-36868 100 µl에 섞었습니다.   2.Solution B: For each transfection, dilute 2-8 µl of siRNA Transfection Reagent: sc-29528 into 100 µl siRNA Transfection Medium: sc-36868. Peak activity should be at about 6 µl siRNA Transfection Reagent. 항목을 수행하기 위해 siRNA Transfection Reagent: sc-29528를 구매하여 100 µl siRNA Transfection Medium: sc-36868에 8 µl를 따서 섞었습니다.   3. Add the siRNA duplex solution (Solution A) directly to the dilute Transfection Reagent (Solution B) using a pipette. Mix gently by pipetting the solution up and down and incubate the mixture 15-45 minutes at room temperature. 3번 항목을 수행하기 위해   1번과 2번에서 만든 시약을 섞고 30분동안 상온에서 반응했습니다.   혹 제가 놓치고 있는 부분이나  잘못된 방법이 있다면, 선생님들의 지혜를 구하고 싶습니다. 다른분들도 도움이 될 수 있기에 글 삭제 안하겠습니다!   siRNA_Protocol도 첨부하였습니다.  
회원작성글 꿈많은청년  |  2022.02.14
Q. lentivirus 사용없이 shRNA 가능한가요?
  ㅜㅜ siRNA 로 transfection 시간당 농도당 해도 단백질 억제가 안되네요  (다른 단백질은 잘해왔는데 이번에 새로하는게 문제예요)   그래서 교수님이 shRNA를 해보는게 어떻냐 하시는데.......  실험실 안전등급이 virus 사용이 안되는 등급이라......    shRNA는 보통 lentivirul particle 이지 않나요?  그냥 shRNA vector를 넣어 단백질발현 억제가 가능한가요?       
회원작성글 땅콩  |  2021.12.17
Q. microRNA detecting molecular beacon을 주문 제작 할 수 있는 국내 기업 알려 주십시오^^
이렇게 특정 sequence의 microRNA 에 붙어서 형광을 발광하는  molecular beacon이 주문 제작 가능한 국내기업 있으시면 정보 부탁드립니다. 감사합니다.  
회원작성글 ERMD2H  |  2021.11.01
Q. 뉴클레오타이드 하나 차이 구분에 대해 조언을 구합니다.
안녕하세요.    핵산쪽에 관련하여 연구하고 있는 중 조언을 구하고자 글 올립니다.   준비한 핵산에서 예를들면 TTTTT(6)개 에서 TTTTT(5)   로 뉴클레오타이드 하나의 차이를 구별할 수 있는 분석법이 있을까요??   GEL로는 분자량이 너무 낮아서 힘들것 같고, 현재 MALDI-TOF 방법을 생각하고 있는데, 다른 적절한 방법이 있다면 알려주시면 감사하겠습니다.
회원작성글 쿠바  |  2021.10.21
이전  1 02 03 04 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
실험 홈  |  실험FAQ
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
필코리아테크놀로지 광고