[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보  |  e브릭몰e브릭몰 sale 회원가입   로그인
BRIC홈 실험
스폰서배너광고 안내  배너1 배너2 배너3 배너4
과학으로 본 코로나19 (COVID-19)
전체보기 안전점검 논문교환 LABox
 카테고리: 전체 > Molecular Biology-DNA > PCR/RT-PCR/Q-PCR
Mol. Biol.-DNA Mol. Biol.-RNA Mol. Biol.-Protein Immunology
Cell Biology Microbiology Plant Biology Laboratory Animals
Omics Chemical biology Bioinformatics Laboratory Equipments
Buffer/Reagent Bioethics Etc.
카테고리 전체보기펼치기
질문/투표/프로토콜 등록
Q. Real time PCR house keeping gene ct값 질문
Sample 별로 GAPDH의 ct 값이 18-20 사이에 해당하면 다른 마커를 상대정량하는데..
회원작성글 명혀 ㄴ  |  11.23
Q. primer 제작시 시작코돈은 안넣어도 되나요 ?
회원작성글 링피맏명  |  11.19
Q. ORF가지고 primer제작 방법
ORF를 알고 있으면 그것에 맞는 primer제작할때는 orf 맨 처음과 끝 이렇게 제작하면 f p..
회원작성글 링피맏명  |  11.19
Q. pcr 증폭시 양을 어떻게 계산하나요 ?
pcr하면 단일가닥이 2개되고 2의 제곱으로 지속해서 증가 되는거 아닌가요 ? 그렇게 전기영동..
회원작성글 링피맏명  |  11.19
Q. 전기영동시 band 확인방법!
전기영동을 하면 밴드가 뜨는걸로 아는데 그 밴드는 primer의 크기가 증폭되어 뜨는 건가요? 아니..
회원작성글 링피맏명  |  11.19
Q. [Genotyping] PCR 조건에 대해 질문 드립니다.
안녕하세요 선생님들, 일본 대학에서 감사하게도 cKO (Cre-loxP system) mo..
회원작성글 리처드빱킨스  |  11.18
Q. Primer design 시 Blast 결과
Primer를 제작 중인데요 Tm값, GC contents, Secondary structur..
회원작성글 감감선  |  11.17
Q. Takara PCR Amplification Kit 에서 control template 질문입니다.
안녕하세요, 이제 막 바이오분야에 입문한 사람입니다. Takara PCR Amplificati..
회원작성글 biobio20  |  11.17
Q. 전기영동 질문입니다. 첨부파일
2% 아가로스 겔로 20분 전기영동 했는데 샘플 밴드만 자꾸 안뜨네요.. PCR을 3번이나 다..
회원작성글 엔도톡신  |  11.14
Q. probe based FMCA PCR
taqman probe 기반 FMCA PCR을 하려고 합니다. 각각의 probe의 Tm값으로..
회원작성글 이뽀글  |  11.13
Q. 전기영동 질문있어요~
아가로스 겔로 전기영동 할 때 보통 시간 어느정도 하시나요? 1.5%랑 2% 농도 같이 쓰고..
회원작성글 엔도톡신  |  11.13
Q. 전기 영동 실험이 실패 했는데 원인을 모르겠습니다. 첨부파일
고수님들 안녕하세요... 직책이 대학생이라고는 되어 있는데, 사실 고등학생입니다. 고등학..
회원작성글 똑똑하구만  |  11.12
Q. qRT-PCR 샘플링 후 몇시간 뒤에 pcr돌려도 괜찮을까요
안녕하세요 실험 초보 석사생입니다 ㅜㅜ 지금 qRT -PCR 돌리기 직전까지 다 샘플링을 마쳤습니..
회원작성글 돔돔  |  11.12
Q. QPCR에서 primer 사용에 관한 문의
안녕하세요,  저는 4T1 cell 을 가지고 emt관련 mRNA발현 확인하고자 qP..
회원작성글 yujeong03  |  11.12
Q. 전기영동 질문입니다
아가로스 겔 1.5%로 18분 진행하였는데요 사이즈마커는 그나마 괜찮은거 같은데 positive c..
회원작성글 엔도톡신  |  11.11
Q. pcr 한거 bp값 예상
  그냥 mini prep 만한거랑 (t7 promoter 로 )pcr 한거 이..
회원작성글 멍청이  |  11.11
Q. QPCR에서 primer 사용에 관한 문의
안녕하세요, 현재 4T1 cellline 에 다른 유전자를 넣어서 qPCR로 ㅡmRNA 발현을..
회원작성글 yujeong03  |  11.11
Q. Pcr Primer Design에 관해 질문드립니다.
Foward : 3' - CGTTTCGACGACGACAAGCCG - 5' Reverse : 5'..
회원작성글 New_H  |  11.11
Q. gapdh undetermined 첨부파일
사진에서 보시다시피 GAPDH 값만 undetermined로 떠요.... cDNA가 합성이 안..
회원작성글 o_o  |  11.11
Q. enzyme cutting 후 PCR
enzyme cutting (one cut) 한 후 에 enzyme 불활성화 65도씨 20분한 후..
회원작성글 쏭달쏭알  |  11.10
이전  1 02 03 04 05 06 07 08 09 10  다음
실험 회원 등급이란?
실험Q&A 회원등급안내
실험 홈  |  실험FAQ  |  실험 문의 및 제안
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의 member@ibric.org
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
에펜도르프코리아 광고