상위피인용논문
- 조회771
Abstract
Kyung-Mi Songa, Minseon Chob, Hunho Joa, Kyoungin Mina, Sung Ho Jeonc, Taisun Kimd, Min Su Hane, Ja Kang Kua, Changill Bana,*
a Department of Chemistry, Pohang University of Science and Technology, Pohang, Gyungbuk 790-784, South Korea
b Department of Mechanical Engineering and Department of Materials, University of California, Santa Barbara, Santa Barbara, CA 93106, USA
c Department of Life Science, Hallym University, Chuncheon-si, Kangwon-do 200-702, South Korea
d Department of Chemistry, Hallym University, Chuncheon-si, Kangwon-do 200-702, South Korea
e Department of Chemistry, Chuang-Ang University, Seoul 156-765, South Korea
*Corresponding author : Changill Ban
Abstract
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (Kd [kanamycin] = 78.8 nM, Kd [kanamycin B] = 84.5 nM, and Kd [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.
Keywords : ssDNA aptamer; SELEX; Colorimetry; Gold nanoparticle; Kanamycin
논문정보
- Research article
- 2011년 08월 (BRIC 등록일 2017-04-03)
- 국내(교신)+국외 연구진
- 120회 이상 인용된 논문
댓글 작성 로그인
팝업 닫기관련 링크
연구자 키워드
연구자 ID
관련분야 연구자보기
소속기관 논문보기
관련분야 논문보기
해당논문 저자보기
