[DEBUG-WINDOW 처리영역 보기]
즐겨찾기  |  뉴스레터  |  오늘의 정보 회원가입   로그인
BRIC홈 실험
스폰서배너광고 안내  배너1 배너2
전체보기 안전점검 논문교환
 전체 > Molecular Biology-DNA > DNA Modification
조회 443  스크랩 인쇄하기 주소복사 트위터 공유 페이스북 공유 
질문 site-directed mutagenesis가 되질 않습니다...
알도오ㅏ주세요(대학원생)  |  02.08 13:48

site-directed mutagenesis를 진행중인 신입 대학원생입니다
UG 염기 두개를 AC로 바꾸는 실험을 진행중인데요 kit를 사용하지 않고 PCR로 진행중입니다

Primer design은 PrimerX site에서 진행하였고 

                                   **
    Forward: 5' CAGGTAAGCACTGAAGACTACTTTTATAAGTGTCCCAAGCG 3'
    Reverse: 5' CGCTTGGGACACTTATAAAAGTAGTCTTCAGTGCTTACCTG 3'
                                    **
     GC content: 43.90%           Location: 56-96
     Melting temp: 78.1°C         Mismatched bases: 2
     Length: 41 bp                Mutation: Substitution
     5' flanking region: 19 bp    Forward primer MW: 12617.35 Da
     3' flanking region: 20 bp    Reverse primer MW: 12590.32 Da


이렇게 제작하였고 책이나 논문 브릭에 나와있는대로 PCR을 진행하였습니다
95°C (30sec) / 95°C (30sec) 55°C(1min) 68°C(9min- template plasmid 크기가 8.5kb정도 됩니다) / 68°C (10min)

DNA (50ng) 1ul
primer F, R 각각 1ul
dNTP(200mM) 1ul
10x pfu buffer 5ul
Pfu nforte 1ul
D.W 40ul 으로 총 50ul

중간에 온도를 50~70
°C까지 바꿔서 30cycle을 돌려봐도 plasmid가 확인되지 않고 또 PCR 시간이나 조건들을 바꿔봐도 확인되지 않고 18 cycle을 돌려 Dpn1을 37도에서 1시간 처리한뒤 DH5a에 transformation을 해봐도 콜로니가 뜨지 않습니다 

또한 이것이 primer 농도의 문제인가 싶어서 125ng, 50pmol, 2.5pmol로 PCR을 돌려봐도 마찬가지입니다 ㅠㅠ

혹시 site-directed mutagenesis를 잘 아시는 분들은 조언바랍니다...
#PCR
 
#site-directed mutagenesis
답변하기
검색광고 검색광고
[(주)필코리아테크놀로지] PCR/qPCR 실험에 사용하는 모든 시약 및 장비
빠르고 정확한 1500만원 미만의 MIC qPCR machine 으로 간편하게 데이터를 얻으세요. NEB사의 LunaScript(13분 cDNA합성완), Luna qPCR mastermix로 쉽고 정확한 데이터를 얻을 수 있습니다. cDNA합성, RT-PCR, PCR, Isothermal PCR, qPCR 관련 kit 및 시약을 모두 제공합니다.
답변 본 정보는 네티즌에 의해 작성된 정보로, 내용 중 중요하다고 생각되는 부분은 추가적인 사실 확인을 반드시 하시길 바랍니다.

PCR reaction시  제 기억으론 pfu DNA polymeration rate가 0.5kb/1min로 알고 있습니다.

8.5kb라면 17분간 해야겠죠..그런데 너무 기네요...


pfu 매뉴얼 확인해보세요. 회사마다 틀릴 수도 있어요.



잘 되지 않는다면 다른 방법도 있습니다.

overlapping PCR 등등...

개구리엑스트라  |  02.08 14:02  

Pfu  증폭 후 전기영동에서 product가 보이나요?

Pfu로 증폭 하기에 너무 긴것 같습니다.

mutagenesis를 포함하는 최소한의 부분만 증폭 해서 vector에 연결하는게 더 편리 할수

있습니다.

아니면 mutagenesis를 포함하는 100 ~ 200bp를 잘라낼수 있다면 oligomer를 합성해서

diret로 fragment를 바꿔줘도 편리하게 실험 할 수도 있습니다.

대왕개구리SPEED  |  02.08 15:30  

다른 방법도 있겠지만, 좀 비싸더라도 좀 더 효율이 좋은 polymerase를 사용하시면 훨씬 쉬우실 것 같아요.
제가 있는 랩에서는 NEB Q5 HF-pol로 SDM을 하고 있는데요, 7-8 Kb 대 template도 문제없이 잘 진행하고 있습니다. Q5의 elongation rate은 Kb 당 20-30초라서 8kb도 사이클 당 약 3-4분 정도면 elongation도 끝납니다. 한 번 고려해보세요!

+) 위에 보니 nPFU-Forte taq을 사용하신다고 적어두셨는데, 해당 제품 프로토콜에는 extension 온도가 72도 권장인데, 68도 말고 72도에서도 해보셨나요?

뒷다리goviral  |  02.08 23:24  

forward와 reverse 서열이 같은 것 아닌가요?

개구리느림보  |  02.12 00:54  

정확히 MUTATION을 하고자 하는 위치가 어딘진 모르겠지만


PRIMER의 길이가 너무 깁니다.


MUTATION을 하고자 하는 부분을 중앙에 위치 시키고 


양쪽으로 15BPS가 넘어가면 PCR이 잘 안 되더라구요.


즉 길다고 잘 붙지 않습니다.


CYCLE은 18번이면 충분합니다. 


참고로 PCR 후 전기 영동으로 BAND가 보이지 않아도 TRANSFORMATION


하면 실험은 가능합니다. 

MSG  |  02.13 10:31   
답변하기
할인행사 광고 검색광고
에펜도르프코리아 에펜도르프코리아
원심분리기 보상판매 Centrifuge Trade-in : 20%특별보상혜택 최대340만원 세이브! (6.30까지)
에펜도르프코리아 에펜도르프코리아
연구실 필수템 에펜도로프 피펫 원심분리기 PCR장비 세포배양기 특별 프로모션 (7.8까지)
그린메이트바이오텍 그린메이트바이오텍
소량의 샘플로 정량 가능한 UV-Vis spectrophotometer를 저렴한 가격에! (6.30까지)
프리미엄 등록안내
최근등록   더보기 >
Trypsin digestion 도와주세요   04.24
멜라닌 측정실험관련해서..   04.23
alignment 프로그램을 사용해야하는데 막막합니다 ㅠ   04.23
혹시 죄송하지만 PCNA항체 나눔해주실 분 계실까요?   04.23
초산발효, 총산도   04.23
DNA 추출실험   04.23
glutaraldehyde 가교 pH   04.23
dna추출 실험을 진행하였는데 농도가 너무 낮게 나왔습니다   04.23
phospho-JNK와 total JNK밴드가 안잡혀요 ㅜㅜ   04.23
hypoxia 할때 cell culture   04.23
(주)엘앤씨바이오
ZEUS
위로가기
실험 홈  |  실험FAQ  |  실험 문의 및 제안
 |  BRIC소개  |  이용안내  |  이용약관  |  개인정보처리방침  |  이메일무단수집거부
Copyright © BRIC. All rights reserved.  |  문의 member@ibric.org
트위터 트위터    페이스북 페이스북   유튜브 유튜브    RSS서비스 RSS
에펜도르프코리아